GenePrediction:GLEAN_1386 Details

Name: GLEAN_1386
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:202757..203520 (+ strand)
Length: 764
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:202757..203048 (+ strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_168:203165..203520 (+ strand)
Length: 356
>GLEAN_1386 class=GenePrediction position=GCSC_168:202757..203520 (+ strand)
ATGGCTGAGCTGCAAAACGCCAATCCCACGATCCTCAGCGCGGCTGAGCTGCCGAGCCGCCGGCTGCGGAGGGAGACGAC
CTCCCGGCACGGCGAGGAGTTCAGGTTCGACAGCATCCTGGCCCCCAAACGGCCCGACAGCCTCTTCTGGGGAGCCTCCC
ACATCGCCGCTCTCGCATCCCCTCCCTCACCGGCGTCCTCCATCTCATCTGGCGGAGATGTCTATGACGAAGGCGACGAT
GGCGACGACGGCGTCTACACGGAAGAGCCGATCGACGAGCAGGAGATTTACGGTACGCCCGGCAGGCAGTGCTACCCTGC
CCCCATCCCTATTATACTGGAATGCACCCTGCTGACGCTCGCACCGCCTCGCGGGCAAAAGACCTGATTTCCACGATATC
CGATCCAGAGCACCCCCACACGCTGGGCCAGCTCTCCGTAGTCAATCTGCCGGACATTCAAATCTCACCGTCCCCGCTGC
TGGCAAAGTCTCTCGACCGCGACACGCTTACCCGGGTGGTGGTCTATGTCACGCCGACTATCAACCACTGCTCTCTGGTG
ACGGTCATCGGCCTTGCCATCCGCGTTCGTCTGGAGCAGACACTGCCGCCCAACTACCGGGTCGATATCGAGGTCAAAGA
AGGCTCCCACAGCCAGGATGACCAGGTCAGCAAGCAGCTGTCGGACAAGGAGCGGGTAGCGGCTGCCCTGGAAAACGATA
CGCTCCGCGGCGTGCTCGATAAAATGCTCGAAACCTGCAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62