GenePrediction:GLEAN_1387 Details

Name: GLEAN_1387
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:208610..209488 (+ strand)
Length: 879
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:208610..208980 (+ strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_168:209050..209488 (+ strand)
Length: 439
>GLEAN_1387 class=GenePrediction position=GCSC_168:208610..209488 (+ strand)
ATGGTAAAGCCGCTCGTTTTCAAAGGCGACAAGAAGCCGAAGAAGAGAAAGCACAGAGACAAGGATGCGGCCGAGGAATC
GCGCAAGAAGCAGGAGCTGATTGCCGCCAACGACGAATCGATTGCCGAAGACGACACCTGGGTTTCAGCCGAAGTCCTGA
CCGACGTAGCTGGTCCTATCTTGCTGGTGCTGCCAAGCGCAACTCCCACGGCCCTGGCCTCGGATGCGAATGGCACCGTC
TTTTCCATGCCGATCGAGAACATTGTGGATGGCAACCCGTCCAGTGCCGAGCCCCATGACGTCCGACAGGTCTGGGTTGC
AAGCCGCATTGTCGGAACGGAACACTTTCGCTTTAAGGGACATCATGGAAGGTGGGTTCCCTGCCTTGGCCTCTGAGCTC
GCTGTTTTTCCTCGTCTTCTGGGCTGACCGGTTACTTTAGATACCTAGGATGCGACAAGTACGGCCTCTTTTCGGCCACG
GCCATCGCTGTGTCCCCGGTAGAGTCGTTTGTGCTCGTCGAGACCGAGGACACGCCCGGCACGTTTCAAATCAAGACCCT
GCGCGACACCTACTTGTCTGTGCAACTGTCGACATCGTCCAAGGCCGGCTCGGCGCCAGAAATCCGCGGCGACGCGACCG
AGAGCAACACCAATACAACAGTGCGCATCCGCATGCAAGCTCGGTTCAAGCCCAAGATCAAGGCGTCCAAGGAAGAGAAG
GCCCGGGAGAAGATTAGCAGGCGCGAGCTGGAAGATGCCGTGGGGCGGCGGCTGGAAGACGACGAGGTGAAGCTGCTCAA
AAAAGCCCGGAGAGAGGGTGACTATCACGAGAAGCTGCTGGATGTAAAAGTCAAGCACAAGCACGACAAGTATGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62