GenePrediction:GLEAN_1388 Details

Name: GLEAN_1388
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:211381..214114 (+ strand)
Length: 2734
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:211381..211408 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_168:211482..211631 (+ strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_168:211722..213677 (+ strand)
Length: 1956
Type: CDS
Source: GLEAN
Position: GCSC_168:213750..214114 (+ strand)
Length: 365
>GLEAN_1388 class=GenePrediction position=GCSC_168:211381..214114 (+ strand)
ATGCGACGGCCCTTTCTTTGGGGCACTCGTAAGCTCGGCGTCCCCTCCCCGCCCATTAGGCTCAATGACGAACGCCGTGA
CTGACCTCCATACCCCGACAGTGCTTCTGCAGGTCATATCCGTGACCTGTGCCGATCCACAGCACAGCGATGTACGAGAA
AAAGGAGCCGCGAAGGATGCCGGGGTCCGGGACCACGTGACGCCGGAAGATATCCTTCTCAGAGCGCCGACCGACAACGG
CCGGGAAAGTGGTATGAGAACACGCTCAGGCTCATCGGGGCCGTGTAGGGGGTCTATGAGTGCGACGTACACCCGATGCT
GACATATGGCGATAATGCTAGGACGTGACCTCGTCGACGCTGCCCTCGTGAAACTGACGACGATACCATCCCAACCACAC
TACCGAAAACGAAAACAAAATGGGTACCTCTCACTAGCCTTTCGCTTTATCCTAAAGGCAATGCCCAGCTTTTCCATGCG
AGGTCCGCCACCACTACAGCAGCAAGATACCTCGTCGCAAGCAGCCCCGATAGCCCTAATCGAGGCCGTGCAGTTGCTCG
AAGAGTCGGCTCGCGAGGACAATCCGGATGCACTGTACCTCCTGGCCGAAATGAACTACTACGGAAACTATTCGCATCCG
AGAAACTTTCCGGCTGCCTTCGACTACTACCGCCGGCTCGCAGACACGCATGGAAACAGCTCGGCACTGTACATGGTCGG
ACTGATGTACTCGACTGGCATTGGCAACGCAGTTGAGCGAGATCAGGCCCGGGCCCTGCTATACTACACATTCGCTGCGC
TGCACGGCCACACCCGGGCTGAAATGACCGTGGCTGCGCGGCATCATGCCGGCATCGGGACCCCTCGGAGCTGTGAGCAA
GCACTGCAGTATTACAAACGCGTGGCGGATAAGGCCATTGCATGGTACCGCTCGGGGCCCCCAGGCGGTATGGGCTGGGT
CCAGCAGCCGTATCGTATAGCAGACGAATTTGGAGGCGTCTACGGCGTAGGGGCCAGCGTCGTCAGCTCAGGAATCCATG
CCCCCCGTGCCCAGCCGCACTCTGACGCCTACGCCTCGATCGACGATATCATCGAGTACCTAGATCTCATGGCACAGAAG
GGAGACTTCAAAGCCGCCCTGAACGTAGGACGGATTTACTACGAGGGCCAGCGGATGCTTGAGCGCGATATGCAGATGGC
ACGGAAGTACTTTTATATGGTGGTGAGCAAGTACTGGAAGAAAGACGGCAGCATCGTGGATAGTCCGAAGCCGTCTCTGG
ATAAAACGGCTGCCAGTGCAGCGGGGTTTCTCGGCCGCATCTACCTGCGCGGAGATGGCGTCGAGCAGAACTTTGAACGG
GCCAAGTTTTGGCTCGACCGCGGAATCGCCTTTGCTGACCCCCAGTCCCAATACCTGATGGGCCTGATGTTGCTGCACGG
TTACGGCGGCACTACCAATGTCGATAGGGCTTCAAAGCTTTTCCGGTCAGCAGCTGAGCAGAACTATACGCCAGCCCAGG
TGGAGCTGGGCGTGCTCTATCTAGACCAGGGACAGGCCGAAGATCTTCGAATAGCAAACGACTACTTTGAGCTGGCGGCT
CGGTACGGAAACATGCAGGCATATTACTACCTGGCCGAGATGATCCACCATGGGGTAGGCCGTGATAAGGCATGTGGACC
GGCTCTGAGCTATTACAAAAGTGTCGCCGAGAAGGCGGATCCGTTGGTGTCGTCCTGGACAGAGGCAAACCAGGCGTACG
AAGATGGAAACTACGAACTGGCTCTGCTCGAGTATCTTGGAGCAGCCGAGCAGGGCTATGAGATGGCCCAGAACAACATC
GGTTATCTGCTAGACCCGCAGCAGTCCAATCTAAAGCTTCCGTCGATTCTCTCTCGCCAGATGGTCAAGAAGGGCCTGCT
GGATGAACCGGCACTGGGCCTGATCCACTACACAAGATCCTCCCGACAGCACAATGTGGATTCGCTTGTCAAGATGGGCG
ACTTTTACCTGTATGGCATCGGCACGAAGAAAGACGTTGATAAAGCGGTGCAATGCTATCTGGGTGCAGCCGAGTACCAC
CAGAGCGCACAGGCGCTGTACAACTTGGGGTGGATGCACGAGAATGGTGTCGGCCTCGACCAGGACTATCATTTGGCGAA
GCGCTTTTACGACTATGCGTTGGAGACCAACGAAGAGGCATACCTGCCGGTGTCGCTGACCTTGTTGAGACTGCGCCTCC
GAAGTGCCTGGAATACATTGACGCATGGCCAGATCAATTCTATCCAGGATGAGCCTGGTTAGTATTCTGTCCCTTCCCCA
CGGGTTTTCGCGAGGCTATGCTTCTGGCACTAACATGTTCGAGTCCCAGCACGAAAATGGTCGTTCAGTGAGTGGATCGA
GACCTTTACTAGCAGCGCCGGATACCATGATGTAGAATACTACGACGAGTACGACGACACGTATTTGGACGACGAAGGCA
GATTTGAAGATCTCCCCGAGTTAGGTTTGGTTGAGCCTGTCATAATCATCGGCGTGGTCATGGCCATTGTGTTTCTACTG
TACTATAGGCAACAGAGACGGATTGCCATCAGACAGGAAGAGGAGGCACGGCAACGACAGCAGCAGGGCCTGGCGCAACA
TCTGCAAGGCTTCCAACCAGCTGCAGACAGGGGCTTCTTCCCGCCACCGGGCCCCGACCAAGCCGCCTGGTTAGCAGGCG
GCGTAGGGCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62