GenePrediction:GLEAN_1390 Details

Name: GLEAN_1390
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:218079..221641 (+ strand)
Length: 3563
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:218079..218628 (+ strand)
Length: 550
Type: CDS
Source: GLEAN
Position: GCSC_168:218694..218839 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_168:218907..221378 (+ strand)
Length: 2472
Type: CDS
Source: GLEAN
Position: GCSC_168:221456..221641 (+ strand)
Length: 186
>GLEAN_1390 class=GenePrediction position=GCSC_168:218079..221641 (+ strand)
ATGTTGCAAGGCCGGCGGCTGGTCGGAGCGACTACGCAGTCGGAATGGGCTGAGCTGGCCGAGTTGGCTGACTTGGCTGG
ATTGGTGGCGGCCGGTGCTGGAAGGGCGGGAGATCTGGCGTGCCAGGCCAACTTAAGCAGGGGCGCAGGTGGTGGCGGCT
CTGTACCGGCTTTTATCAGGCCCTTGCGCCAGTTGACTCATCCTCGTGGAACGTTCTACCCCTCTGGCGCCGTAGCCCCA
CGACCCCTCGAGAACGTTCCTTCCGGCTCTGTCTGCTGCACCGGTCCAGGAGCTCTGAGCAAACCCACCACGACCGCTTG
GAAAAAATTCACCACCACAACTCGCGGCTTCATAAACGGCCACGCCACCAAGCAGCAGCACAACTCTCGGATTGCCGTCT
CGCCCGCCCTCTGCGCTGCTCTGACATTTCGACGCTACCCCGCCCTCTTTGCTCGCCCGTCTTCTACCATGGCCGAGTCG
CCAAAATGGACCGGCCTCAAGGTCCGCCAGACCTTTCTCGAATACTTTGAGAAGAAGGGCCACACCATCGGTAAGGCTCG
CTTGCTCTGGCGAGCTCAATCCCCCTCATCACCTCTCTGGCCTGACCCGTTCCAGTGCCGTCTTCGTCTGTCGTGCCGCA
CAATGACCCGACTCTCCTCTTCACCAACGCTGGCATGAACCAGTTCAAGCCAATTTTCCTCGGCACCGTGGCCAAGGCCG
ACCCTCTGTCCAGCTTGAAGCGTGCTGTCGACACCCAGAAGGTGTGACCGTCTCCTGCTGCTCTGCCCTGCCCTCCTGCT
CCTGAGCCAAAGCTGATCCCCCTTGCAGTGCATCCGTGCTGGCGGCAAGCACAACGATCTCGACGATGTCGGCAAGGACA
GCTACCACCACACCTTCTTTGAGATGCTGGGCAACTGGTCTTTTGGCGACTACTTCAAGAAGGAGGCCATCGAGATGTCA
TGGGACCTGCTCACAAACGTCTACGGCCTCGACCCCGCCCGGCTCTACGTCACATACTTTGAGGGCAACCCGGCCATGGG
ACTCGAGCCCGACCTGGAGGCCAAGAACCTGTGGTTGTCTGTCGGCGTGCCTGAGGACCACATCCTGCCTGGTAACATGA
AGGACAACTTCTGGGAGATGGGCGACCAGGGCCCCTGTGGCCCGTGCAGCGAGGTGCACTACGACAAGGTTGGCGGCGGC
CGCAATGCCTCCAGCCTGGTCAACCAGGACGACCCGCTCGTTGTCGAGGTCTGGAACAATGTGTTCATTCAGTTTGACCG
CCAGCAGGACAAGTCGCTCAAGTCACTGCCTGCCAAGCATGTCGACACCGGCATGGGCTTTGAGCGGCTCGTGTCCGCCC
TGCAGGACAAGATCTCCAACTACGCCACCGACATCTTCACCCCCCTCTTCGATCGCATCCAGGAGGTCACCGGTGCCCGC
CCGTACACGGACAAGTACGGCAAGGACGACGTGGACGGCATTGACACGGCGTACCGTGTTGTGGCCGACCACATCCGTCT
GTTGACCTTTTCGATGGCGGACGGCGCCGTGCCCAACAACGACGGCCGTGGCTACGTCGTTCGCCGCGTGCTGCGGAGAG
GTGTCCGCTATGCGCGCAAGTACTTTGGCGCTGAGATCGGCTCCTTCTTCTCCCAGATCCTGCCCGCGCTCGTCGACCAG
ATGGGCCACCAGTTCCCCGAGATTGCCAAGAAGCAGAAGGACATCAAGGAGATCCTGGACGAGGAGGAAGAGGCGTTTTC
GCGGACTCTGGACCGCGGCGAGAGGCAGTTTGAAAAGTACGCTGCGGCAACGGCCAAGAGCGGCGCCAAGACGCTGTCGG
GAGCCGATGTGTGGCGGCTCTACGACACGTTTGGCTTCCCCGAGGATCTGACGCAGCTGATGGCTGAGGAGCGGGGTCTG
TCAATTGATGCCGAAGAGGTGGCCGTGGCACGGGAGAGGGCGAGAGAGGCCAGCAAGTCGGTCAAGGAGGCGGTGCAGAC
GTTTGCCAAGCTCAACGTGCACCAGATCGCGGAGTTGGAGAACGAGCACAAGATCGTGCGGCCGAGCTCGGAGGCCAAGT
ACCTCCGCGGCGACCTGCACAGCCGGGTGGAGCTGATCTACACGGGCACGGGCTTTGTCAAGACGACCAAGGACATCCCG
GCCAACACGCCGCTGGGCATTCTCGTGGACAAGACCAACTTCTACGCCGAATCGGGTGGCCAGGTGGCGGACACGGGCAG
AATCGTGATTGACGACGTGGCAGAGTTCAAGGTGCTGGACGTGCAGGAGTACGGCGGCTATGTTGTGCACAACGGATACC
TCGAGTACGGTGAGCTGAGCTCGGGCGACAACGTGATCTGCGAGTACGAGGAGCTGCGGCGGGCGCCGATTCGCAACAAC
CACACGGGCACGCACGTTCTGAACCATGCGCTGCGCGAGGTGCTCGGCGACGACGTGAACCAGAAGGGCTCGCTGGTGGA
CCAGGACAAGCTGCGGTTCGACTTCTCGCATAAGTCGGCGGTGAGCCTGGCGGAGATCAAGAAGATCGAGGAGCTAGCGA
ACGCGAACATCCAGCGCAACCTCAAGGTGTTCTACAAGGACGTGGACCTGGCCAGCGCGCGCGAGATCGAGGGCGTGCGG
GCGGTGTTTGGCGAGACGTATCCGGACCCGGTGCGGGTGGTGTCAGTAGGTGTGGACGTGGACGAGCTGCTGCGGACGCC
AAAAAAGGCGGAGTGGCGCGGCTACAGCGTGGAGTTCTGTGGCGGGACGCACGTGGAGCAGACGGGTCTGATCAAGGACG
TGGTGGTGGTGGAGGAGAGCGGAATCGCCAAGGGCATCCGGCGGATTGTGGCATACACGGGCGATGCGGCACACCGGGTA
CAGCGCGAGGCGACACAATTCCAGGAGCGGATCGAGGCGATTGAGAAGCTGCCGTTTGGGCCGGAGAAGGAGACGGAGAT
CAAAGCGGCACAGCACGACCTCAACCAGCTGGCCATTTCGGCGCTGGCCAAGGAGGAGCTGCGGACGCGGTTCGCCAAGG
TGCAGAAGGACGTACTGGACGAGCTGAAGAAGCGGCAAAAAGCCGAGCTGAAGGCGGCTGTCGGCGCGGTGACGGACCAC
TTTGCGAAGCCAGACAACAAGGAATCCAAGGTGTTTGTGGGCCACCTGCCGATCTCAGCCAACGCCAAGGCCATTTCCGA
GGTGATGAACCACTTCAAGACGAAGGACAAGGAGCGGTCCGTGTATGTGTTTGGCGGCAGCCCGTCGGAGGGCGTCGTGC
ACGGCGTATATGTGGGAACTGTGAGTTTTTTTCTTTTCCTTTTCTTTTCTTTTGGTTTTCTCTCCGCCTCTTTTTGATTT
CCCTTCTAACAAATCAGCATCTCGCATCCAAGGGCGTCACGGCGGAGCAGTGGTCGACTGCTGTCAGCGACGTGGTGGGT
GGCAAGGCGGGCGGCAAGGAGCCGACTCGGCAAGGCTCGGGAACAAAGCCAGAGAAGCTCGAGGACGGCGTGAAGCGGGC
AGAGGAGTGGCTGGCCGAGAAGCTGAAGGGGTTGGAACTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62