GenePrediction:GLEAN_1392 Details

Name: GLEAN_1392
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:230909..233050 (+ strand)
Length: 2142
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:230909..230956 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_168:231024..231261 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_168:231316..231618 (+ strand)
Length: 303
Type: CDS
Source: GLEAN
Position: GCSC_168:231696..232234 (+ strand)
Length: 539
Type: CDS
Source: GLEAN
Position: GCSC_168:232586..233050 (+ strand)
Length: 465
>GLEAN_1392 class=GenePrediction position=GCSC_168:230909..233050 (+ strand)
ATGGCGAGCTCGTTTGAAAAGTCCGTCAAGGGCGCTACCAAGGTCAAGGTATGTCCTTTAGCTCCCTTCTCAATGGCCGC
GTTGCCAGCTGTCTGACCGTGCACTCTCCCTGCAGCTTGCGCCGCCGAAAACAAAGTACATTGAGCACATTCTGATCGCC
ACACATGCGGGCGAGGCTGGCGTCGGCGAGGTGTTCCGTGCTCTCCAGTTTCGCATGCGGGAAACTTCGTGGACGACCGT
CTTCAAGAGTCTGATCACCATCCACCTGATGATCCGCGAAGGCTCTCCCGACATCACACTAGCCTATCTTTCCACGAACA
GAGGCCTGTTGGTGCCCTCTGCCATAACGGACGGTAAGCATGGGTAGGGCGAACAGACGGTAGAAAGAAGCTGACATCCG
GCCGCAGGTCAGGTCCAAGGCCGGAATATACGGCACTACTCGACGTACCTGAACGAGCGGGCAAAGGCATACCGCGACAC
CAAGGTCGACTGGGTGCGCGCAAAGGAGTCGATCCTGGAGAAGCTGACGGTCGACAAGGGCCTGTTGCGGGAAACCGAGG
CGGTGCAGAACCAGCTGACGGCGCTCCTCAAGTGCGACATGGTGGACGACGACACGGGCAATGAGATCACCATCTTTGTC
TTCCGGCTGCTGGTTCTGGACCTGCTCTCGCTCTTCCAGGTGCTCAACCAGGCGATGATCAACATCCTAGGTACGTGTGT
GCACCACTGTTGGGCGCCCTCTGAACCCTTCGCTCGGCATGCGCGACTGCTAAGACTGGGGCGGCAGGCCACTTCTTTGA
GATGTCCAAGGTCGACGCCGAGCGGGCCATGCAGATCTATCTTACCTTTACGCGACAGACCGACTTTGTGGTGCAATACC
TCACCGTGGCGCGCCAGTACGAGCACCAGACGCGCGTGGAGGTGCCGAAGCTCAAGCACGCGCCCGTGAATCTGGGCCGT
CAGCTGGAGGAGTATCTCAAAGACCCGGACTTTGAGGTCCACCGGAGGCAGTACCTCGCCGAGATTGCCACCAAAAAGTC
CAAGGGCAGCTCGGGTGACGGCGCCAAGGCATCCGGCTCCAAGGCTGCCGCGTCCAGCCAGGCCGACAATGCGGCAACGT
CGGTACCGAAGCTGGCACCGCCACCAGGATCGAAGCCGCCGCAGCCGAGGGGGCCCGACCAGAACCTGATCGACTTCTTC
GGCTCCATCGAGCAGAACCAGACGCCCATGGCGGTCCAGGCCAGCCAGCAGCCGCAGCCGATGGCCGGAGCGTCGCCTTG
GGGGGCACAGCCGGCAGCGGGCATGTTCCAGCAGCCGACGGGCTTCGTGGCCCAGCCGACGGGCTATGCGTCGACGAACC
CGTTCCAGATGCAGGCCACGGGAGCAGCTGTCGGGTTCGCCCAGCCGCAGCAGCAGATGCAGCAGATGCAACAGATGCAG
CAAATGCAGCAGCAGCAGCAGATGCAACAGCAACAGACGCAGCAGCAACAGATGCAACAGCAACAAGTGCAACAGCAACA
AATGCAGCAGCAGCAGCAGCAGCAGCCACAGCCGCAACAGCCAGCGTTTACGGGCATGGGCTTTGGCGGGTTCACGGCAC
AGCCACAACCACAGCTGTTGCAGCCGCAGCAGACGGCCTTCCAGCCGCAGCAGGCGAACCTGCTGGCGCTGCCGCAGATG
GCCATGCCGACGGGCCAGCAGCCGAACACGAACCCGTTCCGGCAGTCGATGATGACCCAGACGGCGACGGGCAGCAACAC
GTCCGCAGTGGCAGCGAGTCCGCTGGTGGCGGCGACGACCGGATCTACGAATCCGTTTGCGCGCGCCTCACCGCAGGCGG
CGGCAGCACCGGCGGCAGCACCGCTCGTGGCGATGCGGACGGGCACAAACCCATTTGCGCGAAACAACGGAGGCGGCGGT
GCCGGCAGCGACGGACAGCAGCAGCGGCCAGCGACGGCAGGAGGCATCAGCGCGCTGGCACCACAGCCGACGGGCACGAC
GAACCCGTTCCGACAGGCAGCGTTTGTGAACCAGCAGACGGGGATGGGATGGCAGCACAACCAGCCGACGGGCAACTTGT
TGGATCAGCTGGACACGGTGTCGGTATTTCCACGGCCGGCAACAGGCGGACAGTGGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62