GenePrediction:GLEAN_1401 Details

Name: GLEAN_1401
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:269416..273006 (+ strand)
Length: 3591
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:269416..269611 (+ strand)
Length: 196
Type: CDS
Source: GLEAN
Position: GCSC_168:269683..269828 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_168:269905..269998 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_168:270062..272836 (+ strand)
Length: 2775
Type: CDS
Source: GLEAN
Position: GCSC_168:272894..273006 (+ strand)
Length: 113
>GLEAN_1401 class=GenePrediction position=GCSC_168:269416..273006 (+ strand)
ATGCCCAGCATATTTTCCCGCTTGAAGGGCAAGGATGGCTCCACAAAGACCAGGTCCAAAAAAAACGGCGCAAACGACCT
TGCCAACAAACTGCCAACCAAGCCGCTGTGGGACGATGCCTACACCCGGAAGACGGTCGAACCAGAAGAGATTCGGGAGC
TGGTGAAGGTTTGCACTGCAGAGCTCAAGGCGAGAGGTACACCACCGCTTCCCCTCTTTTTCAGCTCTCCAAATGGCCAA
CCCAAAACTGACTCCCAAACCTCACAGGTCTCGACATCCCGTTTCTCCTCCTCCCTTTTCGGCCCACATCGGACCCTAGT
GCGGTCCGGACATTCGTGCGCCACTTCTTTGACACCAGTGCCGGCGTGTCTGGCGATGTGCTCTTGCAGGAGCTTCGCAT
GACGGAGCCAATGGTACGCTTCTGAGCAACGGTCCAAACTAGTGTTCTTGTGCTCACGGCTAACAACGGATTGCGTACTA
TCTACACAGGTGATTTCAGGTGTCATCAAGTGGTGTTGGAGCCGCTTACAGGGAGGAGTTGTCGGCTGGGATGCTTACGA
ACTTTTTAAAATTGGAGAGCAAGGTACGAGTGGTGGTTCTCGAGCGCTCAACTTGTGAACCGGGCGCTAACCCCATATTG
CTGCAGATTCAAACGAAGCTCCCGACTCATTCAACACTTTCATCCCGCTTAGCGTCGACAATGCGGCCCGAGCGGGCATC
ATATTCGACCTCTTCGACCTTCTTTCTGCCATTGCTGCGCATGGCAAGGCAAATGGATTCGGTGGCCGGAAGTTGTCTCG
TATGGCATCGTGGTGGGCCTTTGACAGTAAGGGCACTGGAAATGGGTTTGAGGGCGGTTACAAGGATTGGCTAAAGGCGG
CGGATGCTACCAGCCATCTGTTCTTTGCCTACCTCCGGTCACTCTCGCCTGCCCGGGGACCTGGAAGCTTTGCCACACTT
CCAATGTCGCTACAGAAGCTGCTGCAAGAGACGGAATACCCTCCCCAGAGACCGGTGTTGCTACAAACGTCCACGTTCAG
GGTGATTATGATTGTCGATAACGTGTCTCCTACCCCATTCTCTCTGCTTCGTCGGGGCAGTCATTTCGAGTACCGAGACG
AAGATCGTGCGCTTCGTGAATTTTCCGATTACGAAGACCCGGTCCAGGCTTTGACGGATGAATGTCGCAGAGTTCTTAAG
GCGATCTCCGCGGCCAACCAGACCCAAGCGGTGTCCAGCTCCAAACACTCCACCAGTCTTCGCGACGCGTCCTGGTCACG
ATTTGAAGACGTAGGTTTCGGCAGCCTTATCGAAGAGGATGAAGACGACGAGGAGAAAAACAACCTAGCAGCCAAGAGGA
ACCATGCCCTGAGGACGACGCCAGCTTCCGGTGGCAATGGGCTTGGCAGACCAACGACCCCTTCGTGGGCGGACTTTCTT
TCCTCTGGCTTTGTGGACGACGGCCCGAACAGCCCTTCAAACATACTTCTTCCCCCAGACAAGATTTTGCCGCCGATTGA
CACAAACACCCGTCAACGGAGCTCGCAATCCCACCGGCCTCGCCTGGAAACGGAACGTGCACTAGAACCTGGCGAGCTCG
CGAGCATCAGCCGCTTCGACTTGGACGACGCCTTCTGGTGGGTGTGGATGAGCAGTCTGGCACCCGAGGAGACACCTGAG
CGAAAGTCGGCTTTTGGGCGTTGTGCTGTCATCGAGACGAGCATTAAAGCAGGCCGATGGCTGGTCATGGAAGAGGTCGT
TAAGGGCGCTGCTGCAGAGCCTGACGAAGGTGCCTATATTGCAGAAAAGAAGGGCTTCTTCAGCTGGACTCGTCGAAACA
AGGGTATTTCTCGCAGCAAGTCTGTGGGCAAGCAATCTCATGATAAGCGCAATGGACAAGGACAGCTCATGCCAGGAGGC
GACGCGGCCAGTGCTAGTAGGACGAGTATCGCAGCCAACCAGCAGGCGAAGATCCAGGCAGCAGCACAGAAGCTACAGGC
CAGACACCAACAGGAGGAAAGAGAGCGAAACGGCTCTGATGTGGCATTGAGCAGACGTGGACGCACAGAAAGCCATGCTG
CTGAAAAGACAACCAGCGTCTTCACTCTTCAGCCTGTGATTGCTTCTGAGGCGTCTCCCGCACTGAAGTGGGCCAGCAAA
TATGACAAGGAGGCTATACGAGAAAAGTATCTCGGCAACATCAATGCTGGCCGTGGCCAGTTATCCGTGTCATCGCCCAA
TGTCCATTTAAGCGGCCTACCATCCCCGACGGGTAGCTATAATAGCACAGCCACAGAGGATGCGATAGAGAAACCAGCGA
CCCAGATACCTCGGCTGTCGCCGCTGGCAACATCGTCAACAACTCCCGCCCTGTCTCCAAAGCCTGCTGTCAGTACCGTG
CAGTCGCCAACTCTTCTTTCGCCGGCTTCCGTGAAGGACCGAATCGCGAACCTGACAGAGAAGTCGAAGGCGGCTCCGGC
TCCGGCGCCGATAAGCCCTCGCATTGCAGTTTCGGAGCCGTCTAGCATGTTGGGACCGGCCTCACCTCGGGTGCCACCGA
AAGACACGCCGGAAGACACGCCGACAAAATTGGAACCTGTTCCAGTCCCTGCGTCCAACCCCGAGGGAAAGAAGGCTGTC
AACAAACTTCACAAAGACGGCAAGGAAAAGGAGGCTGACGAGAAGAACAAAGATCTGCCTACGTCCGCAACCGCAAATGG
GGGATTCCGCAAACTATTCAACCGCAAGAACCGACAATCTAAGCTTCCCGAGAACGCAGGCGCTGATGTGAGTGCGATGC
TGGCAGCGGCCGCTGCGGAAAGCAGTAGCTCCAACCCTTCACCCAAGCCGACTGCACCAGCCGAAGAAGTAGCTCCGACA
CGTCCAATTGCGGCTCCGATTGCAGCAGCCGTGAATCTAGCTCCAGCTGCTGCCGCACCGCCTGCTTCTCCAGCTAGGAA
GCCAGTTCCGGTACGGGCTACTCCGTCAGCCATCCCCGTCTACAAGGAGCCTGTTGTCGGGCTGTCCGAGCCGGCACCGG
TTGCCGAGCCAGCTGATGTCACGTCTGGCAACTCGGTCCCCGGCGTTGATACTGCCGAGGAGATGGAGGTCAAGACGGAT
TTCAACCGTTTCGACCAGTGTCCTCTTGACCAGCCAGCGTTCGTCCCAGAAGACTCTGACACCGAAGAAGAGGCAGTCCC
CCCGCCGATTGCCCGCCAGCGATCGCCCGTATCGCCGAAGCTCGTATCCCCTGCACCAGTGCCGGAACCAGCCGAGCCGA
GCTTACCGCCGGCGCTGGATCGGTGGGCTCAGATTCGGAAAAACGCAGCTGATCGTGCAGCACAACGCCAGACGGAAGTA
CCGCCGAGCACGACGTACACCAAGCCCAAGGGGGCGGGTGAAGCTGCGAGTGGTGAAGAGAGTACGTAACTCATGTTTCT
GTCCTGTTCTCTGACCAACCCTGCTAATAGTCCTGCAGCGATTGAGTCTCGCGTTGCTCGGATCAAGGCACGCGTGGCTG
AATTGACCGGCAACATGGAGGGAGTTAATGGCCCTGGCAGTCGGCCTGCGCCTCTGCCCATCCGCCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62