GenePrediction:GLEAN_1402 Details

Name: GLEAN_1402
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:278661..281422 (+ strand)
Length: 2762
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:278661..279071 (+ strand)
Length: 411
Type: CDS
Source: GLEAN
Position: GCSC_168:279134..281422 (+ strand)
Length: 2289
>GLEAN_1402 class=GenePrediction position=GCSC_168:278661..281422 (+ strand)
ATGACGGCGCCTCATAACAACGGCTTCACACCTCGAATGCAGTCCACGCGAACGACAACAGCCAGACACAGGTCCGGGCT
TCTCTCGGACGGCGACGACTTTGGCGGTCTGTCTGCCAACATCGCCCGGCTCCTTTACAGATACGTGCTGCGCAAGGCTG
CCGAGACGTCTCGGATGGCAGGCAGCATGATCAGATCGAACGGTGGCCACGGCCGACGACAGCGACCGCCTCTGCTTGTC
CGACTATTGCAGACGGCGTGGTGGCACATGCGACGCAACCTGACGCGACGGCGGCTGTTCAGCGTGCCGCACCTGCTCGT
GGGCTTCTGGATGCTGGTGTTGCTCTGGGGCGAGCGGTGGATCTTCCATGCCAGAGTGGCCCATTGCGACTGGGGTCATT
GGGAGAAATGGGTGAGTGGTGGAGGAGGGAAGGCGACGTCGAAGCCGACTGCTGACGATGCGGACGAATGTAGCCTTCAG
GAGCGACACCCCACCGAGTCATCTTTGTGGCGGATCCGCAGATCACGGATGCGCACTCGTATCCCGGACGGCCGTGGCCG
CTGAGCGCGCTGACGGTGATGCTCACGGACAACTACATGCGGCGGTCATACCGCGAGCTGCAGGAGCAGCTGCGGCCGGA
CACGCTTTTTTTTCTGGGCGACCTGTTTGACGGGGGACGCGAGTGGAGGCCTTCGCGCGGCGAGTTTGGGGAGCTGGCGT
GGAGCAGCCGGCCGGAGAGCGAGAAGGCGTGGGCACGGGTGTGGCAGAAAAAGTACGCGGAGGACTACTGGCTAGGCGAA
TACGCGCGGTTTGGCGACATCTTCCTAGACGACTGGAACGTCGGCGGCTTCAGAACGAGGGCGGGCCAGCGTGGCCGACG
GCTGATTGCCAGTCTGCCGGGCAACCACGATCTGGGATTCGGGTCGGAGGTGCAGCAGTCGGTGCGCAACCGGTTCGAGA
GCTTCTTTGGCGAGGGCAACCGGGTGGACGTGGTGGGCAACCACACGTTTGTGTCGGTGGACACGGTGTCGCTCAGTGCC
GACACGTCGGAGCGGGCGAGCCAGCCGGACATGCAGCCGATCTACGGCCCGACACAGCACTTTTTGGACGACGTGGCCTG
GACGAAGAAGAAAGCGGTGGCGCGTGAGCTGCGGCACCAGCACGGTCTCGGCGAGGAGGTGGTGTTTGCGCACCGGGTCG
AGGACCTGGACGAGGCGCAGTTTGACGTGGATGGGCTCCGACAAGCGCTGAGCAGCAGCAGCAGTGTGGATGGGGATGCA
GTAGCAGACCTGCCGACGATCCTGCTCACACACGTGCCGCTATACCGACCACCAGGAACGCCGTGTGGGCCTCTGCGGGA
GCACTGGCCGCCGACAAAGCCGTCGTCTGCGGACGTCGATGCCGAGGGCAAGCCGCAGCCGGTGTTTCCCGACGATCGCA
ACGCGATCTCGGTCACGCGTGGATACCAGTACCAGAACGTGCTGAGCGAGGCCGACTCGATCCGGCTGGTCCGGAGCGTG
GGCAACGTGGTGCAGGCCTTCTCGGGCGACGACCACGACTACTGCACGGTGGTGCACGACGAGCGCCAGGACCACGTGCC
CGAGATCACGGTCAAGGCCTTCAACATGGCCATGGGCGTGCCGACGCCCGGCTTCCTGATGCTCAGCCTGCACAACCCGG
TGGACGCGGCCGGCCGACCACTGACTCCGGCAGCCGCCACCGGCAGCACCATGCAGACGCACCTGTGTCTGCTGCCCAAC
CAGCTGGGCACGTTTGCGCGCTATGCCGGCATGGTGGTCGTGTCGCTGGTGCTGCTGGCCGCGCGCGCCGTGCTCGTGCC
CGTGCTGGGCTGGCAGCCGTTTGCGCTGGGTCCACGTGACGGGCGGCTGTCCGATGGTGGTGGTGGTGACTCGATCTCAA
AGTCGCGCTCGTCGTCTGTGCTGCCGCTGTACAGCAAGGCCAAGGTGGAGGACGACGAGTACGGCGGCAAGAAGAGCTCG
TCAGTAGCAGCAGCAGCAGCAGCGAGCAATGGCAGTGTGGACGAGCCTGGCAACGTGTCTGGAAACGAAAAGGGAGGTGC
GAGCGGCTCGTCCGGCTTCTTTGCGCCACAGGCAGCCGCAGCGACGTACTCGCGAGGCCGGGCCCAGGTGAACGGCCGTT
CTGGCTATGGTTATGGCGGTGGTGGCGACAGCAGTCTGGGCGGATTGGCGCCGCCATACCAGCATCCACACCGACACAAG
AACCGCAGCGGCCGTCCGCGCCGGTCGTCCAGGGCGTCGGCATCACCGGCCTACGCACCCAAGATCGAGATCGTCCGTGA
TGAGGACGACTCATACGGCGACGATTCCTCGTACGACAGCTTTGCCAACGAGGGCGGCGACGGGAGAACGGCGTACTTGG
TTGGTGGTGGTGGTGGTGGCAGCAACCGGTGGAAGCCGGCCGCACGACGACGACGACTGCTCATTGCCGGGCGGACGGCT
CTCGCGAGCCTGAAGCGGCTCGTCTGGAGCACGCTGGGACTTCGTGGCAGCGGACGTGGTCGCTGGCGTCAGGCCGGCTT
CGGGTTCATGTATCGCGGGCTGAACGGCGGCAATGGCGACGATGACAGCAGCCAGCGACGGCGACATGGCGGACTGCACG
CCCAGGATGGACAACCCCGTGCAGGAACGCTGCAGGTGGCCGGACGCGAGTTCTGGACGACGACCTGGCGCTTAACCTGG
ATGGTCGTCGTCTTCTGGGCATGGCTAAACCACAGGGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62