GenePrediction:GLEAN_1403 Details

Name: GLEAN_1403
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:282108..285201 (+ strand)
Length: 3094
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:282108..283374 (+ strand)
Length: 1267
Type: CDS
Source: GLEAN
Position: GCSC_168:284363..284474 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_168:284553..284692 (+ strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_168:284750..285201 (+ strand)
Length: 452
>GLEAN_1403 class=GenePrediction position=GCSC_168:282108..285201 (+ strand)
ATGTGGCCGACGCATCACAGATTGCCCCAGCAGTCCAAGGCCGAGCCCAAGGCCGAGCCAACGCGCAAATGGCGCGATGG
CAAGCTGACTTTCCTGCCTCTGCGCGGCCCTGTGCGTGGCTCGTCTGTCTCCTCGGTCGCTTCTTCGCAAGCAGAGCCGG
CTGGTTTTCGCAGCGCCGTGCCGCCGGCCGACTATCCTCTGGGTCAGCGCGCGCGGCTGCAGGCGACGGCGCAGGAGACC
CTGAACGTGCTGCCGGGTCTGCTGCACGAGCTGGGCACAATGCAGGATGCCAGCGACACGGAGAAGCTGACGGTCGACGC
CGCTCCACGGCTGCACCCCGATCGCTGTCCGGCGTTTTCGCGGCCGGCCACAATTCGTGTCGTGGACGATGACACGCTCA
ACGTGGCCGTCGCTTTGGGCAGCTGCCAGCTTCACGGCCACTCGCAGCGGCCGCCGATCGTGGTCAACTTTGCCAATCGC
CGCCATCCTGGTGGCGGCTGGCGAAATGGCGCCATGGCCCAGGAGGAGGCTCTCTGCTACCGCAGCTCGCTCTCGCTGAG
CCTGCACCAGAGCCTCTACCCGCTCGGCCGCGACGAGGTCTTCTACAGCCGCTACGTGCTGGTCATGCGCAGCGACATGT
CCTCGGGCCACCACCTGCTGGCGCCAGCCGTGCCGCCCCGGCTTCTGCCTGTCGTCAGCGCCGTCACCGTGGCTGCCTTG
TATCGACCCCCGGTGCAATCGCTGACCGTTCGGGGCGCCGGCCACGACGAGCAGAGAGAGCAGCACCGGTCACGCAAGAG
ACGCCAGCAGCACGGCCACGAGGATGATCGCTGCAAGCGTGAGCGGAACGACAGCAGAGAGGGCAGAGAGAGCAGAGCCA
GCAGAGCCAGCAGTCAGACGGCAGACGGACGCGCAGTCAGGCCTGATAGCCGGATGCACAGCTCAGACGATTACGGGGAT
GGCGAGATCGATAATGCCTACGACTGTCTGCTGGATCCAGAGCTGGCGGCAGCCAGAGCAATGGCCTCGTCGCCAAGATC
GTCTAGACCGTCGTCACCACCGGGACACACGAAGCTGGTCTTTGCAAAGGATCGCGACCGCGATGCCACAAAGGCCAAGA
TGCGTCTGACGCTGCGAGCAGCCGCCCGTCATGGCCACGACCAGCTCGTGCTGGGCGCCCTGGGCTGTGGCGTGTTCGGC
AACCCGGCCGAAGATGTGGCCCACTGCTGGCTCGAGGTCCTGCACGAAGACGAGTTTGCCGGCGCTGGTCACTGGTGGCG
CGACGTCGTCTTTGCCGTCTATGCCGGCAGCGGCAGCAACAACAGCAGCAGCAGCCGCGATAGCAGCAACTACAGCATAT
TTCGGCAAGTCCTAGACGGACAACAGGTGTAGGGCGGTGGTGCACTCCTGGAAGAAATCCACAGCCAATGAACCCCTCTT
CTGCAACTCTTCTGTGAGTAAAGTGCAGAAAGCCTTGCTTGCCTTTGACCCCGGCTTCCTTTCCGCCGTCTGCATCTTCC
TGAAATATCCACAACCCCCACACACACTCTGCCTCATTCTCCCCGGGAGCTGTCCATTGGCCGTCCGGCAAGCATCCATC
GCTCCGTTTCTGGCCCTCTTCAAAGCCAATCGCGCACCCATGCTGCTGGTTGCCTTGCATCGGCAGCCAACGCACAATCC
AGGTGGCCCGACCCCACTGGCTGCCCGACCATGAGGCAATCGAATCACAGGCCTGCTGGTGCTCTCGTGTCTCTATCTGG
CCCTGCACCCCTGTCGCTCTTTCGACTCGTGCCTGACCCGAGCGGCCGAAGGTGATGGGCCGGCTGTCCAGCCACATTCG
ATCTTCACCTCTCGATATAAACACCCTGCATCCACGCTCTTCCCCGGTCCAAGCGCTCACTCATTCTCATGCTCGTCTCG
CCTGCCGCAATGATGGCTACCTATCCCAGCTTCCACTCCCACTGGCCTCTACAACAGGATCATCTGCCTCTTCGACACGA
CCGAAAGGATGTGCAGTATAACATCGTCGACGTTCCCCGGTCTGTCTACAGTATTGTCCAAGCTCGCCGGGTATGTTTGT
CCGTCATAGCTCGCTGTCTTTCGGACCCAAACGCATGTTCTTAACCCTGACCTAACGTCTTCCTCCTGATGCAGGAACTA
CTTTCTGTGTCACCAAACGATAGACTGTTCATCAAATGCAAGTCCGCCATATCTCTTTTCCCCTCTCGGTTGTCGACTTT
TCTAACCCCTTACAGTCAAAAGTCTCTTCGATATTGGCTGGCAACACCCTGGCAAAAGGGCCGCGGTAACGGCCGTATAC
TTCTGGGGCCAGAAGGAACTGTCGCTGGCATCCTCCACTTCAGACCCGTACGTGCCCATCTTTTCCTTGCTCATCTGTCA
CGACGCCAGCAGAGTAACAGCCCTAACCGAATCCACGCTTCACAGCTTGAGTCTGCGGTCAGACTACTACTTCCACGGCA
CCCGTCGGTCTTGCAGCATCGGTGACTACGGCGTGCAGCCCTGCCACAACAGCGACTGCAACCTGTGCAGCATCCTTCGC
GACTCTTTCAAACTCAGCCGAGCAGGTACTATATATACTCTCCCAACGCAAATCACCGAATCTTCTCTGACTCTCGCGAC
AGACTCTGCCGGTATGTTTGGCCCGGGGATCTACACCACGCCAATATCCTCAAGTAAGCAAGATGAACCGCAGGACTGCC
TATACCGCAACCAGAACTGGACCGGAACTGACCTCAAGCTGCAGAAGCCGATCTCTATGCCAAAAATCACCATCTTCGCT
CCTTGGAGCACGCCATGCTTCTCTGCCGAGTCATGTGCAGCCGGCCACAGCCACTCTACCGGCCAGATCAAAACCGCACC
GGACCGGATCTTGGATACGATGCTGTATGTGCACCCAATCACGAATGTCTTAGTCAGCACCAGAGCACTAACAGCTTCCC
TTATCCAGGTCAGGGCCGTCACCAGAGACAAGGGCGGTGCTGTCGACTACCCCGAAATTGTTCTCTACGACGAAAAAGCC
ATTGTCCCATGCGGCTTAATAATGTATACTCGTGAAGGTTGGATGCCTCGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62