GenePrediction:GLEAN_140 Details

Name: GLEAN_140
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:949298..951455 (+ strand)
Length: 2158
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:949298..949504 (+ strand)
Length: 207
Type: CDS
Source: GLEAN
Position: GCSC_179:949609..949630 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_179:949711..951455 (+ strand)
Length: 1745
>GLEAN_140 class=GenePrediction position=GCSC_179:949298..951455 (+ strand)
ATGGTGGCCGTCATGGACCGGTTGACACACAAGCTAACGTGGTTCGAGGACGTCTTTGACAACACGATTGTCGCGCAATG
GCGTGAAGAGCTGGACCGGGATCACTTCATCGCGAGCCCCCGGCTGATGAAAGGCAAGACCTGGGACTGGTGCGTGCAGG
AGCTCCGCGACAAAGCCGTCTACTACAAGGAGCATCAGCATATACGCGTGCTGGATACCGGTCCTTGTGTCTGCAAGGTC
GATAATGCTAGGCTCCAGCCCCTCGGTGCGTTACTCCGGCGGGCTGCTAACCCGCTAATCGACGTACAAAGCAAATCAAC
AGCGCCAAGAACGGTGAGAGTGGCTTGAGAATAGCCAGATGAAGCAGTTTCGACAGGAAGCGGGCGGATGTATTGATGCG
GATGCAAAAGCAGGTGTGGAAGCATGTGTGGATGCAGGTGTGAACGCACAGCCAAACATGGGACTGTACGCTCAAGCCAA
CGACCACGAGCCAAGTTGGTTCGCCACAGAAAAAAGAGAAGAAAGAGAAGAAGCTAGCCATATGACTACGGGCGAGCAGA
TTGAAATCAACAACGAGCAGGAGTTCGAGGACGAGCATCAAGCAGAGGACCAAAATCTCGCATTGGACCAGAACACGGCA
TATACTCTTTCATATGACGAAGAGATGGACAAATTAACCGATGTTACAGCTGATTCAGACTGGGACTGGAAGAGCCAGGC
ATGGCAGCCGAACAAAGGCAGCATACTCAACATCGCTGGGTCCGCTCACATGATTTCCACCCTCGTCGATCCGCTGCTAT
TTCCGCTGGTGTACGGTAAAACTGATGTTTTACAACATGGGGGCACTGTCCCTCTTAGCAATGTACTGGCATCATATGGC
GCCACACAAACCGCACCGCAGCCCATGGCGGGCGAAACCCTCCAGGCTACATGTCCCTGGAGTCGAAAATATCAGAGTCT
TCCGTGCGAGGTCGCATTTGATAACGACAGCGGCGATAGCAACAATAACAAAGTCAAAATCACATCATACATCAATGGAC
TTCACTCCAACCACGCAGGGATGTACCTGGCCATCGAACGGGTGCTCGCATGCGTCATACAGCCCTGGAATGACTGTCTT
GTCCGTGGAGACCGCGACATGGTCGACCGTTGCAACCTGGGCCAGCTAGGACCTATCCCGGCTCGCATCATCACATACGG
TATGGAATGGGAAAATGAACTACCCGATTGGGCGACTGCGTTCCGGATTCCGACTAAAGGCAGGAAACAGGAATACTTTG
AAAACCAGAAGATACTGCAACGCCTACCAAAGGACGTCAGGAAGAGGAAATGGGAAGACGACGGCCTAGCATTTGAATTT
GCCGACGTCATTAATAAAGAACACCGGACTCTGCCACCACGAGACTCGGACCCGTGGCGGCGAGCCAGAGAATATCTCGA
GAGGCCCGAGCAGAACCTCAATACGGACGAAACCACCTGCGTAAATCAAGTCACCATGCCCCCTAACGACTGGGTCATAG
GGGACGAAAGAACGTGGGATCTCTGCGAGAAGACCGAGCGACTGATCTGCTACAGGCATCCCGAACCGGGAACGGCTTTC
AACTACGAAGAGTGGAAGATGGGCCGCCATAATAGCCGGCCAATCGTAGACAAGGCAGTTCCAGAACCGAGGCAAATTAC
AGAACGCTTCCGGTGCCCGCCGTTTACCCCGCCACACATGCGTTATTTGGTAGCGTTGCAAGACCACTTCCGGGACCAGG
GCCTGCAAGTGCTAGCCGAGACCAGTAGCATCGAGCTTACACCGGAGGCACCGGCCTATGCACCGCACGCGGCCGCTCGA
GCGGAAGTGTATGCCGCGAGGACTGCTAAAAAAATTGCAATGGCCTTGTCTGAGTGTAAACCTATATACCCGATAAGACA
ACCAGACAAAGATGGCTGGCAACTGTCCGGCCAGCTGAATGAGCACATTGCTGCTGTTGCCGTATTCGTATTTGATGTTG
TAGAGAACATCACCGAGCCTCGCCTGGCCTTTCGCCAGAGAACGTCTTTAGACTATTCGCTCCACCGATACGACGAGTTT
TATCAGCCGCCGGCTAATGCTTCGAAAGACTATAACGCTTGGGCTGACGGGCCAGCCCATATGATGGGCAAAGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62