GenePrediction:GLEAN_141 Details

Name: GLEAN_141
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:952786..960115 (+ strand)
Length: 7330
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:952786..953828 (+ strand)
Length: 1043
Type: CDS
Source: GLEAN
Position: GCSC_179:954108..954281 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_179:954332..956507 (+ strand)
Length: 2176
Type: CDS
Source: GLEAN
Position: GCSC_179:957065..957285 (+ strand)
Length: 221
Type: CDS
Source: GLEAN
Position: GCSC_179:957341..957946 (+ strand)
Length: 606
Type: CDS
Source: GLEAN
Position: GCSC_179:958892..958973 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_179:959068..959340 (+ strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_179:959398..959588 (+ strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_179:959914..960115 (+ strand)
Length: 202
>GLEAN_141 class=GenePrediction position=GCSC_179:952786..960115 (+ strand)
ATGTCAAAATGCCTCAAATTCACTGCGACCGCCGTTGTTGAGTGGGACCAATCCGACGAAAGGCACTTTTTCACCGACCC
CGATGCCCGCTCCAAGTTGACGTTCGAGGGTCGCTTCTACGACGATCCAGGCTTATGCAGCTTTTTCCAGCTTTCCGTTC
CAGTCTACCTCCAAGGCATCTCGTGCAGCACGAAAATACTGCTGCCAATCTATCCCGACGCTATCACAGCCCTTGAATCG
GAAAGATTGCCCTCTTCGCCAGCCTTTGTGGACAAGAAATTGCCCGGCAGCTGTGTTTATTTGCGCTTCCGGCTTGCTCG
CCCCATCTGCATGATTGTTCCAGTCAAGGCAAAGACGCCGCTCACACCTGGGCGACATGTCTCGGCCAACGTGCTCGACA
ATCTTCGCTCCTTAGCACAAGCTACAGAAATGACAGTGTACGTTTCGGATCGCAAGCTTTCGAGAGATAAGGTGCAGACG
ATACAGGGCAAGCTCGAGACGCACAGGACAATTCCACAAACGCGTTCAGCGCCGCCCACACACGACTTGGCCTGTTTGTT
TGGCGGCACAGGCGGTAAAATAATCGACTGCTCTGCTGAGAGCCCTCCGTCGTACGATCAAATTGGTCTGCCACCACCGT
CACTGTCTCTCTCCGATCTTGCCACAAAGCCTGGGCCGAGCAGCACGAAGCGACATCGACGAGATTCCTCAACATCGGAG
GAAGCCCATAGCCGTTCCGACATTCACTGGGCCGTCTTGTACAAAAAATTCGAAGAGCTTGAAGATCGGGTGCAAGAGCT
GGAGCGCGAAAAGAAAGAGGGAGCCGAGGAGGTAGACGCGTTGCGTCTTGAGCTGGACAAAGCTGCTGCTGCCAACGAAG
AATTAGAAGCCGAGTTGTTCTCGACCACCGAGAGGCTTGATAGTCTGGTAGAGAAGGTAGAATACTTGCAAGAGAATGGA
ATAGACAGCGACGTGGAAGAGCGCATAGTCGACACGGTCACAGATCGAGTTTTTGAACGTATTTCGGAAAGTCTTACTGT
TACGTTTACAAGAATGTAAAGAATTTGGCCAATCTTCGATGGGTTCAACTAAACGCGCATGCACGCCGTACCAGAAATAG
AAGGCACAGACCGTCTGTGCCTTACGCCCTAGTGATGTAAGATAGGTTGCTGTCGGGCAAACTGCCTTTGTTTACCGTCG
ACAACCCTACCAGAAGCGAACGTACTGTGATAAAAATAAAGGGGATCTAACCCATAATCTGGCAGCAACCTCAAGTAAGC
AGACAGCCGTTTCCAAAGACAGATGTGCTGAACGAGAACCAGCACTTCGATGGCTACAATCAACTACCAGCAGGCAAAGG
AACTGGTCCTGCAAATTGCAAATGACCATGGCTATCTCCCCGAAGAAAAGCTTCGACTGCTGCCAGCCGACCTTCGCCGC
GACATCGAAGAAGCATTCCTGAAAAAAGACTTGATGATAGGATCGTCGGTCATCACGTACGTATCCACACCTAAAGCGGG
CCTGAACTTTATTAACACGTCGGAAGACTGGCGAAGAACCTGTACACAAGCAAGGCTCGATTCATTTTCGAGCTCCTACA
AAATGCCGACGACAACAGCTATACGCACGCCGCCGCATCCCATGTCGATCCCTACGTCTCGTTTCGCGTGCATTCTGACC
GGGTCGTCATCGAGTGCAATGAGGACGGCTTCAACAGTGCGAATCTCAAGGCTATCTGCTCTATCGGACAGAGCTCCAAG
ATGGGTGCCCAGGGATACATTGGAGAGAAGGGCATCGGCTTCAAGTCTGTCTTCATGGCGGCCTCAAAGGTGCACATTCA
GTCAGGAGCCTTTTCTTTTTCCTTCACACACCGGCCAGGAGATTCTGGCATGGGCATGATCTCCCCGGTATGGGAAGAGC
CGGGCGAAGAGCTGCAGCCGCACCTGACGCGGATTACATTGTTTCTGCATGGCGGCGGCGACGGCGAGAAACATGCACAA
ATACAAGACGCCATCGCAACACAGTTCCAAGAGCTGCAGGAGACTTTCCTCCTATTTATGCGGAACCTGCGAAGCATTCG
AGTTGCTTTTTTTGATGACGGCGGAGCCAAGACGGAGTCATGCACATACTTGATCAAACGGCCGCAGACAGACATGGCCA
TTCTCAAGAGGACCTGGGCTACTCATGGGTCGAAAGAAACGTCCGAAGAGATTTCCAAACACTTTTATGTGGTAACACAC
CAAGCCACAGACCTCACAATGAACGAGAACAGGACGTACTCGGAAGCCGAAAAGGCCTCGGGGGCCTACACCACTTCTCA
GGTTGTCCTGGCCTTTCCACTCTCAGCAGAGTCTACTCCCATCCTCGAGGAGCAAGATCTGTTTGTCTTCCTCCCCGTTC
GCAAATATGGCTTCAACTTTATCATCCAGGCCGATTTTGTCACCGACGCCAACCGTCAGGATATTGTCACCGACTCCGTC
CGCAATGCCCGCCTCATGAACAGTGTGGCTGAGGGCTTTTGCAAGGCCATGCTACGGGTGAGCAAGCAAGACTCCTTGCG
CTACAAGTGGATGCACTACTTGCCAAGAAAGCAGACACAGCGGACTGGTCTCTGGGAGCATCTGGTAAAATGCATCGACA
CCTGTCTCGCGGCCACACCAGTGCTGTATGATCGGAAAGGCTCGGGACGGCTCATAAAGCATCTCATTCGCGTAAAGGAC
CACGCCCTTGACGAGAACGGCGAGCTCCTATTTGATGACGGCCACCCCAGTAAAGTCGTGTCACGGGACTACGCAGAAGA
CGACCTGGACATTCTCACGGAGTACGGCCTCTCCTATGCATCATTTTCTACGATTCTTGGATGGATAAAAGCAGATCTGG
CGAAGCCTCTTGGCCAATCACGCATGAAGTCTTCTACGACGTCCACCTCCTGGCATACACGTGCGGCCATACTCCTCCGG
CGGCCGTTTGAGGAAAATATGAAAAAACTCTCGCAAGAAGTGAAGAAACTGCCGTTATTGCCTCTGGAAGGGGGTGACTG
GGTGCGTCCATCCAATGCGGTTTTCTTTGCCGATGTGAACCGGATGGCCATTCCTCCGGATATTGGCCTCTCTTTGATTT
CAAGCCAGATCACGAACCCTACCCGGCTTCTGCTTTTCAAAGACCTAGGAACTCAGGAGGCCTCTGTATCGCTTGTTCGA
GAGAAAATTATAAGCAGCTACGGGTCGTCCAATGCACAGCCCTTATCGTTGGCGGCCTCTCAGAAGCACTTGAAGTTTCT
CTACTTGACCGACCATTTGAAGACAGACCGAAACACTAGCCTTCTAGGCTTGAGGATATACGACAACAGAGGCATTGTGC
GTCGTCTGTTCGACAAAAACAATCCCATTTACCTCGTCAACACTGACCCGTATGGGCCTTGGGAGGTGCTCAGACCGACT
GAGAAAGGCCCAAATATGGGAGACGGAGCTCCAGGGCTCGAAGTTTTCTTCGCAAACGAGGCATACCTCAAAGAGGAAGC
AGTGCAATCTGAATCAGACGTGACATGGGCAACCTGGTTTCGCGACCGACTCGAAGTGAACATCCACATCATTCTCGGCG
GGAAAATAGCGGAATACGTACAGCAGCACAGACCTGATAAGTTTGTCGGTGCTCTTCGCGTGTTTCATGATAAAAATGGG
AAGCTGTCACGAGGGTACATTGATTGGGCTGTTGGAAGCGAAGTTCTGTGTGCAGGCAACCGCCTCATTCCACTTTTCCA
AGTTTACTTTCCTACCAAACCCTTGAAAAACACAGTTGCCAGGTTTTGTGAGACAGGTGTCTTTTTCCCTTGGCTCTGGC
TGGATGACACCAACGCGGGGGAATATGAAGCTATCCCAGCCAGTTGGAAGCCAATGTTGACAACACTCGGCATGGGGACT
CTTCGCTCGGAACTCTCATTTTCTCTAGACATCCTGGTTTACGCGGTGCGGGGCATAACTCGCGGATCGGTATCCTTTCT
TTCTGAAGCAAAGAAAAGTATCTTTCGACTCTACGAACATATCCTGGGTAAAGTCAGGGAGAGTAAGGACACCAGAGCGG
CAGAAAAGACGGTCTGGTAAGGCGCGGCGAAGAAACAGAAAAACGTCCGCACGGCGAACATATGCTGACGCGCTTCATCA
GTGACTGGTTCAATGATTACAGATTGATTATCATTCCCTCTGAGCCCCCCAAATGGGCTTTACCAAACGAATGCGTATGG
AATGCACCTGTGGAACTAGAGTCGACACATGCATTAAAGCTGTTATACAAGCCATTCATGTCCGACGACACTAGCCTGTA
TATCGAGGCTTTCTTCGCGAAAATCCTCAAGATTGGCAATTGCACTGCAAGCACGTACATTGACGAGCTCCAGACCCTCA
AGGCCTCTGACCGCAAAGACGGTGGTGTTGTAGCCGAACTCTACAGAGCGCTCAGTACCCTCCGTCCGGAAATGATGAAC
GAGACGAAGATAAAAATCAGGTCAGTGCTATGTGTCACCAACGGAGGACAATCTCTTTTTGACTGAAATATCCAGGGCTT
CGTTTGAAGCGAACGCGCTCATCTACGTCCCGTCGAATGACGGCCCGGCCTGGCGCAAGCCCGCAGAGTGCGTATGGTCC
AGTGCAATCAAGCTGCGGAACCGGGTTTCGCTCGGCGAGGAGTACAAAGACCTCAAGGGCCTCTTTGTGGACCTCATCGG
CGTCAAGACAGTGGACCTGGCCATGGCCATCGCTGAGTTGGAGTCGGTAGGCCAGAAGCAGTCGTCAATGGCAGAAGTGC
GGGACTCAATCTGGGCTGTAAACTCGCTCCTGGTCGACAGCGTCGAGGCGCAAAGGCCTGAAAAAATCTTGACCTTGGCC
ATATTCCCATGCAAGTTCCCCGACGGCCACATCGGCTACGTGCCAGCATCGACCGAGTTCTTCATAGGCGATCGTGCGAA
CTGGAACAAGTCGTTCGGCGACAGGGTGAGGCTTCTGGACTTTGATTTGCGCGAAGTCGGCCAGCTGTTGCCTTTCTTCT
CTTGGATCGGCTTGCAAGATCGCTATTTGTCCCGCTGTTGCCGTGAAACCACATCGATCCACGGCGCTACGAGCCGAGCA
TTGAAGCACCAGATCCAAAACAGGGCGCATGCTTTGCTAAGGTTTGTCTGTTCTATTTATGCGCTGGAGATGGGTGGCGG
CTTTGCACTGACGACTGTACGCAGGATTGCGCACCACTTTGATAGCAGCCGTACTGCAACAAGAGGTGACCGGCTATCGT
TCTACGAGTACCTGCGGAAAACGAAAGTGCTCGAAAGCGATGGGATCTCGACCGATATCCAGCTTTTGCAAGACGGTGTG
ATTCATACGGCTGAGGCCACACGGCCGACTCTGCATGTGGACGACGACGATAGCGACGTGCCTGGAATGCACATCTTCCT
GCCGCGGGACCCGGACAATCAAAAGTATACGTTCCAGAAGGACCTGCCGCATAAACTATCAGCGATCATAACAGCAGACT
CTAGCTCCCAGATCGAGGCGGACGTGGTGACGGCAATCCGGGAAGTCTTGACAGCGCCGCTCCCAATGCTAGAGATTGCT
CTAAACGATCTTGGGATCGGAGACGTTGACATTGAGAACGTTGACGGAACGCAGGAGGAGGTCCAGACACACCCGGAAGA
CCAGCCACGCCTGATAGTTACGCTTCCGCATCAGTTTGCTCCTCCATCATCAGAGCATGTTCCTTCACCACCGGCGCAGC
GAGAAGACGTGCCAGACGTGAAAGTTTCGCTTCCGCACCGGACTTTCCCCTCTAGACCAACGCATGTTTCTCCACTACCG
GCGTGGCGAACATACGTGCCAGACGTGGATTCGGCCTCTTCCACGACGGTGGTATCGACTGCGGTGTATGATGGCGCGTC
CAGTGGAAGCAATACAATGTCTCATACAAGGCCACGACTGTTACAAGTGCCCACAGCGCCTCCCCAAAACAACGACAGTG
ACGCTGGCTTTGTACAGCTCCTATGCAGGGTTATCTCTGCAGGGTCATTGGATTCAATCCCTCCGGAGGGGATGTGCAGC
GACAGCTGCTGCAAAGCGGGTTTCAGATACGACAACCCAACGCCGCACATGGGTACCGCTGACATCACAAAGCGAAACCT
GTTGATTGGCGCGGCGGGTGAGGTCTATGTAAGTTCGTTCTGGTTGATTCGCAGGTAGGCAAAAGCTGACAGGCTAGGTT
TTTGAGATGCTGTCGCACTTGCCGGGGCCTTATAAACTCCAGGACTTTGGCAGGAACAAGTGTTGGCAAAGCTCGATCCG
GCACTACGTTGCCGTTCACCCTGAATACAGCCGACTCACGCAATGGGTGGGACAAGAAACATCCGACATCCGGTACAGTG
ACGCCCAGGGAAAACTGACGGCGTATCTCATCGAGTTGGGCTATTTGGACGCAAGCACCTGGCAGGGCGCCACACCAGAG
TACTTTATCGAGGTCAAGACGACCACGTCGTCGTGTAAGACGCCATTCTTCGTAAGCTCCAAGCAATACGACAGGGTAGG
TTTCACTTCCTGGTGGCTTGAAGTGCAGGCGAGGCACTGACAATAAGAATAGATGAATGACGTATTGTACGGAGATACAT
CGAAGGTCTACATGATCTTCCGCGTGTTTCATCTAGGCCAGCAGAACATGGGCTGCAAGATTTACGTCGATCCGGCGGCG
GCGGATGACTGTGGCAAGTTGAGATTTACCCCGTCAACGTGGTCCGTTGTACCTGGCCAGCTCTATTCCGGGTCTGAGGG
CGAGTATGGCTACGTGTACCACGACGGAGACGAGGACAAGGATGAAGACGAGGATGAAGACGAGGATGAGGATGAAGATT
CAAGCGCATGGAAAGGTTTCTTGGACGTGCGCCGATTTGGAGTGAATGCAAAGAGAAGTCACGGGATCTGTTAAATTACA
GGTGCCTAAGACGAAGTAAGCGACAATGTATCCCGAACTATGTACGTGCATACGCCCTTACAATATTCTTCCATTACACT
GCTCAAGCCTCCACATGTCGCCTATTTCGGCCAACTAAACAGGACAATTTTCCAGGGCAACCCTAGTACAACACATCCTT
CCGTGTAGGCTTAACGCGGTCGGCATAGTTCAGGACCAGCCAGATGTCCTGGTAGCCGCCGTGGTGGTGGAAGCTGGCGA
CGACTTTGTGGACGGCAGCAGCGGCAATAGTCCAGGAGGCGGCGGTGCCCTCAGAGATCTCGCCGTAGCGCAGCGGGCGG
CGCAAGTGCGGCTCCAGGCGATCGTCGATCCGGCTGTTGGATGGCCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62