GenePrediction:GLEAN_142 Details

Name: GLEAN_142
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:960498..961545 (+ strand)
Length: 1048
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:960498..960521 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_179:960597..960752 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_179:960818..960921 (+ strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_179:960986..961302 (+ strand)
Length: 317
Type: CDS
Source: GLEAN
Position: GCSC_179:961355..961545 (+ strand)
Length: 191
>GLEAN_142 class=GenePrediction position=GCSC_179:960498..961545 (+ strand)
ATGTCTTCGTGGGTGATTACCGGAGTCTCGCGTGGCCTTGGCGTACGCTTCTACCCCTGTTCCATCCAGTAAGCTCATGA
CTAATACATGATCATCTAGTTCGAGTTCGTCCGCCAGCTCTCTGAAAACCCAGACAACACCGTCTTCGGCCTCGTCCGTA
ATAAAGTAGCTGTCGAGTCCAAGGTTTCCGCTGAGATCGGCCGGAAACATATTCACATCATTCAGGCCGACACGACGGAC
CCAGTGGCATTGGAGGTAAGCTGACGAGTAGTCAATAGTATATTGGAACAGCAGTTGGAGCTAACGCAAACATCTCATAG
AAAGCAGCTCGGTATGTTTCGGAGAAAACCAATGGCGCCCTTGATTACATTGTGGCCAATGCTGCGCTTCAATCCAAGAC
TGCGTTGGTTGGCTTTGATACGTTGTAAGTTCCTGGTACAGTAACGAAGTTCCCTGGGATGTTTGAGTAGAGATTGATCT
CTCCACAGGAGCCGCGATCCCAAAGCCCTCGAACAAGATCTGAGTGACCACTTCCGAGTCAATACGATCGGTGCCGTCCA
TCTCTTCAATACTTTCATGCCCCTGATTCTGAAAGGTCGGGCGAAGAAAGTTATTGCCATCTCTACTGGCATGTCAGACC
CCGAGATGACACTCAAAGGCGACATCTACCAAGCCACCGCTTATGCAATGAGCAAGGCGGCCCTCAATATGGCGATAGCC
AAGTTCAGCGCCTTGTATTGTGAGAAAGGTGTCCTCTGCATGGCTATATGCCCCGGTGCTGTAGACACCGGTAGTCTCAA
CATTGGTATGTAATCCCCTTGCAAATCGATATGGATGATTTTGCTAAGTTTTGACAGAAACGGAGGAGGAGAAGCTGCAG
GCCATGGTTATGTTTGAGAGGATGAAAATATATTCACCCACCTTCCAAGGACCTCTGACGCCGGAAGACAGTGCCACATC
GGTCTTGGCTCTCGTTAAAAAGGCTACCGTTACTGGTGGCTATGCAGGCGTGTTTATCTCTCATACGGAATCAAAGCCGT
ATCTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62