GenePrediction:GLEAN_143 Details

Name: GLEAN_143
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:966541..967548 (+ strand)
Length: 1008
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:966541..966638 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_179:966710..967133 (+ strand)
Length: 424
Type: CDS
Source: GLEAN
Position: GCSC_179:967189..967548 (+ strand)
Length: 360
>GLEAN_143 class=GenePrediction position=GCSC_179:966541..967548 (+ strand)
ATGGCGACGACATCGTCACGTCGCGACGTGGCCACGTTGCTCAAGTACTACGACGACCCGGGCGACGGCTCGCCGCCGGC
ACCAGTAATTGTTGGCAGGTGAGATACACCGCCGACCTGTCGTCATCGTCAGAAGCCGGGCTGCAGGCTGACCAGACCAA
AACCTGCAGGGGTACTGTGAAGAATGAGCGGGCGATGATCGAGGCGCGGACCGTCGTCGAGGATATGACCGGCCGCGAGG
CCGCCTTCACGCTCGACAGCTGTGGCTTCCAGCTGGTTCACCACGCAAGCACGGCCACCGGCTGCCGTGACGACTGCTTC
CGCAACGAAAGTCTGATCGAGGCCGAGTACATTGGCGACTGTGAGCGGCTGCTGCAGGCCGTCACTGGTGCTGTCCGTGT
CTTTGTTTTTGAGCACAAGGTGCGCCGCGGCCCGGCTGACTGGCACAAGCTGGGGCCCGGCAACGCAGCCAAACGTGGAC
CTCTGCACCGCGCTCACGTCGACCAGTCGTACGGTGGCGCCGAGCAGCTGCTCCGCTACTACTTTCCCGACGAGGCCGAC
GGCCTGCTGCAGCGACGCTATCAGATTGTGAATGTGGGTGTGACCTGTCCGTGCTTCTGTGCTTCTCTTCTCTGATTTTA
ATCCCCAGGCCTGGCGTCCTATCAAAACAATCCACAAAGATCCCCTCGGTGTGGCCGATGCCCGTTCTGTTCCCGATGAC
GACCTTGTCGAGGCCCGTGTCATATATCCCGATCACGAGATGTGCACCTGGACCATCAGGCCTGGGCCAGACATCGCTCG
CGGCGCTGACCCCGTGCCCACGACCGCTCATCGCTGGTTCTACAAGCACGCCCAGACGCCTGACGAAGTCATGCTCATCA
AGTGCTTCGACAGCATCGCCGATGGCTCTGTCGCCCGTCGGGCCGCTCACTCGGCATTTAACGACGCTGGCTACGACGAC
GCGGAGCCACGCGAGAGTATCGAAATCCGCTCGTTTTTGTTCTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62