GenePrediction:GLEAN_1448 Details

Name: GLEAN_1448
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:533351..535656 (+ strand)
Length: 2306
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:533351..533402 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_168:533463..533845 (+ strand)
Length: 383
Type: CDS
Source: GLEAN
Position: GCSC_168:533919..534185 (+ strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_168:534235..535656 (+ strand)
Length: 1422
>GLEAN_1448 class=GenePrediction position=GCSC_168:533351..535656 (+ strand)
ATGGCGGTAACGAAAAAGAAGAGACGGCTCGAGACAGAGCCACAAACGCAAGGTAAGCGCGGCCGTGTAGGATGAAGCAG
TCCTCATGTTACTGATAGGCTGTCATTTCCAGTTGCTGCCACTTCTACTGCTGCTACTGCAGCAGCTGCAGCCCCGGCGA
TGAGCGCCTTTGCGTTGCGTCGCAGGCTGCTGCAGAAGGCCGAGGTGCCAGTCGTGGGCGGCGACATCGGGATACAGGCT
GCTCCGACAGGCGAGTCGTGTGGAAGCAGCGGTCCGGATGACGACAGCACGACACGGCCAGCAGGCCAGACAGAGCCGGA
TAGCAGGCCAGCCAGTGCGACCAAAACATCCGAGGCAATTGAGACGGCAGATGAGCCATCCGGCTTCAAGCCCAGACGGG
AGGCACCGGTGCAGCGATCCACGTTCCGGCCGACGAAGCAGAACTGTCGGCATCGGGCGGATGGGAGCATGCGGCTGAAG
CTGGCCGAGGGAGAGGTGAGTGTTGAAGGTGCTGGATAGCATGGACACGCATGCAGATGCTGACTCGGTATATGTTACAC
ACACACAGCGACTGGTCATCCTGGGAAGCTACGGCGTCGTTGTCGGCAGCGGTGAGGTGACAGTGGCCGGCGCAACATTG
CGGCCAAGGCGACAGGCCTACTGGGTGCATGCGCCACAGTGCCACGCACTGCCGATAGTGCGGTGCACCGACGAGGCGAC
CGTGACGCTGGTGCCTCACCTCGGGGCGGCCGGGCTGCGGAAGCTGGAGCGGCTCGCGCCCGTGTTTGGTCAGCTGTGGA
ATGAGACAAAAGAGGCCAAGGAGACCTTTCAAATAGTGGGTACTTTCTGCTCGTGCCATCTCTCTTATGCTGACGTCCTC
ACAGCTGTACACGCCGCAAGACGGGACGACACGGTCACAGGGGCTGGTGTCGCCTCCAGAGTGGAACAAGCTCATGGCAG
AGCTGGCAGCAGCCAAGCGGACCGGCAGCAGGCGATCCGGAGGGGCTGGGGTATACTTTGTGTGTGGACCCAAGGGGTCG
GGCAAGTCGACGTTCTCAAGGTTGCTGACTAATCGACTACTGACCGAAGAGGCCTCGACGGGCGGCGCGGTGGCGATGCT
GGACATTGACCCGGGACAGCCCGAGTTTGCGACACCAGGAACGGTGTCCCTGGTACGAGTGAGCGAGCCGAACCTGTCGC
CGCCGTTCTGCCATCCATACGTGGCCAGCCGGGGCAGTCCGGGCAGCTCAGGCAGTCCGGGCAGCGTCCAGCGGCTGCGG
GCCCACGACCTAGCGGCAGCATCGCTGGCCAGCGACCCAGAACATTACATTGCGTGCGTGATGGATCTGTACGGGGCGTA
CCAGCGAGACCAGCGAGACCAAGGCGGGCGGCGCTGTCCGCTGGTGATCAACACACCGGGCTGGGTGCTAGGCACGGGGC
TGGACGTGCTGGCCGAGCTGGTACGACGCATGCGGCCATCCCGGGTGGTGTACATGTCACAGGACGGACCAGAGGAGACG
ATGCAGGGGCTGCGGGCGGCCTATGTGGACGTGCCACTGGTGGCGCTGCCGTCGCAGCCGAGCGAGTACACGTCGCGGAC
GGCACAGCACCTGCGAGCGATGCAGACGATGTCGTACCTGCACCTGGATCTGGGTGACAAAGAAGCCAAAGACGGGCTCT
CGTGGGACCCGACGCCGCTGACGGCCGTGCGGCCATGGGTAGTGCCGTATGCAAGCGGACCCGAGAGCGGCATCCTGGGC
GTTCTGTGCTACGACTACCAGCCGGGGCCGGAGCTGCTGGCCGATGCTATTAACGGAACGGTGGTGTCGATCGTGGCCGT
CGAGCGGGCGGCCGCGGTTTGGTCGGATGACGGCGTGGAGAGCTTGCCGGTCGTGTGCTCGCCCGAAGGCCTGCCGTGCA
TCGTGAACAGCGAGAGCACGGGTCTGGACCCGTTGCACTCGTATGCCGTGGGCGTGGCACTGCTCCGGGGCATCGACACG
ACGACGCAGACGCTGCAGCTGCTGACGCCGGTGTCGGCTGCCGCAGCCGTGGCCGAAGTGCTGCGCCAAGATGGCCTTGG
CGTCGTGCTCGTGTCGGGAAAGCAGGACGCGCCCACGTGGGCATATACGGAGGAGCTGTACCGACGGCGAGCAGACGTCG
AGGCCGAGGCTGACGGCGACGAGGTCCGACACGGTGACGACGAGGCGATGCCGTGGGTGGAGGTGCTGCATGGCAACGAA
AAGAGGGCTGTCGGATCGCAGGTGTGGAGAGTGAGGCGGGATCTTGGCCGAAACAACGGCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62