GenePrediction:GLEAN_144 Details

Name: GLEAN_144
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:971070..973351 (+ strand)
Length: 2282
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:971070..971535 (+ strand)
Length: 466
Type: CDS
Source: GLEAN
Position: GCSC_179:971591..972296 (+ strand)
Length: 706
Type: CDS
Source: GLEAN
Position: GCSC_179:973288..973351 (+ strand)
Length: 64
>GLEAN_144 class=GenePrediction position=GCSC_179:971070..973351 (+ strand)
ATGTTGGCCATTCCTGTCCTCAGTTCGACAGTCGACCTCTGCGACCGCTGTGCGCGCGGCGCCATTATCCAAGACGATAC
GGATGAGTTCCGTGAGGATATCAACGAGGACGGCACTCCGACACTGCACCATGCACACGAAGACGGCAACAAGTCAATCC
GGCTTCGCTCTGTTCTGCGATGGGACGACGATGCACCAGAATTCCCTGCCATGCTCCAGTCGGCAACGGGAGAACAGGGG
AAGGAAGGCTGTCGACTGTGTAGGCTCGTGCACCAGGCACTCAAGCGTCGCCGACTGAACCATCGCGGTCCCACCACCAT
CATGGCTGCGTATGTGTGGGGAGGAAACCGAGACCGCTATCTGAGTAGCTACTCTGACGATGGCCTGGTCTACATGCGTT
GTGAGGTTTTCAGTAAAACGCCTCCGGCTTTGGCCTACATCGTCTTTGGAGTACAGGTCGCAGACCGTACGTCCCGTTCC
CGGGCGCAATAATCTAGCTCGAACTAATCTTGACAATTCAGATGACCTGTCAACATGGCTGCGGTCCGATGGCTGTCGTC
AAGCCGAGCCTCTGTCGCCCGACAACGTTGAATGGATTCGTTCCACGCTCGTCGACTGGGACGAAGACCCCGGGACCCAA
AGCGTAGGGGGCTTCGTCCCGTCCCGTCTCGTCTACGTAGGCGTCGATGACGACCAGACAGACTCGCCCCGGCTGGTGCT
AACAGAAGGCTGGAAGGACCCATTACCGAAATATGCCGCGCTGAGCTACTGCTGGGGCCCGGGGCACGACGCGGCCAGGC
AGCTGACGACCAAAACCTCCAATCTCGACTCCCATCTAACGAAGTTGCCACAGGAGGATCTCACGCCAGTCCTGCGAGAT
GCCATTGCTGTGTGCCGCTCTCTCTCAATCCCGTATATATGGATTGACGCAGTCTGTATTGTCCAGGACGACTCCGCAGA
TTGGTCAAGCGAGAGCGAAGTCATGGGATACATATACTACCATGCGTACCTTACCATCTGCCCGTTGGCTGCTTCAAGCT
GCATGCATGGATTCTTGGAGCCCCGGACAGCTGGTGTTGATATTCCTTTCCAGTCGCAGAGACATCCTGAAATATCTGGG
CTCATCACTCTGGTCGAGTGTTACAACGACCGAGATATTCCTCCACAGCAGACAACCATTCGGTCTCGACCAGGATTCGA
CTTGGACTCGCCTCTGTGGATGGACAGGTCCCTTTCGAGCTGGGAAACGCGTGGGTGGACATTCCAGGAGGACTACCTCT
CATCACGGGCTATTTATTTTGGGAGAAACATGGTACACATGGGCAGCCCAAAAAGCAGCATATCTGAGACAGGTTTCGTT
GAACTTGGTGATGGAGTTGCCGGACCAATGAAAGGTCTTCTGGACATGGCCGTGAAGATAGCTGGGCCTAAGGCATTGAC
GAATACGACCCAGGCTTCGGCGGGGCCCCTCGAAATGGATTCTCTCGTCGTTGGTGGTCCCGAAGAAACCGCAATTTCAA
TCTGGAGCATGCTGTCTGCCATCTGCCGCCGTGAGCTAACAAAGGCACAAGACTTTCTTCCTGCCATCGCGGGAATGGCA
AAAGCCTATAACCAAATCCACAACGATATCTACTTAGCCGGCCTTTGGGAGCGCTGCTTGCACCTACAGCTGCTTTGGAG
CATGTCACAGCCGCCATCTGGCACATTGGAATCAACACTCGAAGAATTAAAGAGGAACGGAACAGCAGAGGCGCCTTACA
TTTCGCCATCGTGGAGCTGGGCACGCATTGCGCTCGTAAGGCACTTTGAGTTACTTATTTCCAACCACTACTCGATCTCT
GGGACAGAAGAGAATACAGACAAGTTGTTCATGCTGACTGGGTATGGCCTCTCTCATCTGAAACGTGAGTTTTCTCTCAC
AGGCTACTCTGTCGACCTTAATGAACCGAGCCAGTATGGAAGCATACGGCATGCATCTCTTCGCATTCGAGGCAAAATTA
TTTCTATCCCAACTGCCACCATGCACCCGAAGGGCGATGGCCGGCCGCCATTTGCGTATTTTGCTGGGGGGTTAGGGACG
ATGGAATTGGACTGGCAGACAGAAGCAGAAACGGCATTATCAAGTCCATCACTGCGGCTGCTTTTCACAACGTCCTGCTG
CCAGGCCACTAGCAATGAGCTACTGAGGTTCATTGCTAATCCTGACGAGGACCATGAGAGCGGCCTGGCTGACCGACCGA
TTTATCCTGAAGGCTTTCAACCAGACACCTCTGGCGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62