GenePrediction:GLEAN_1450 Details

Name: GLEAN_1450
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:542742..545915 (+ strand)
Length: 3174
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:542742..542860 (+ strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_168:542918..545097 (+ strand)
Length: 2180
Type: CDS
Source: GLEAN
Position: GCSC_168:545155..545915 (+ strand)
Length: 761
>GLEAN_1450 class=GenePrediction position=GCSC_168:542742..545915 (+ strand)
ATGGCGAGTTTTATCCGCGGAAAGCAGGCAGGCATGCAGAATGACCTGTCGGCCGGCATTCTGCCAGGCGTCTTTACGCC
CGAAGAGCAGGTTCGCTACGGAGTGGCTTCTCAGATCAGGTGAGTGTTTGTTCTCGGCGCGTTGCCAGTCTCTAGGCCGT
GCTCTGACAGGTATAGCTGTCTCGCATACGACCCGGTGCAGTCGCTGCTGGCGGTGGGCACGACGCAGTCACGGTTTGGA
CGCGGCACGATCTACGTGTACGGGCAGGGCCGCGTGCATCGGGTGATCCAGCCCAAAGGCGGCGCGTCTCTGCGACAGCT
GCAGTTCAGTGCGAACAGGCTGGTCAGCCTGGACGCCAAGAGCGAGCTGGCACTGTGGAACCTGGACACGGGCGAGCGGG
TGGCCGGGACGGTGTCGGCAGGACCGGCAGCAGCGATGGCGACAGATCCGATGCTGGACTGGGCCTTTCTGGGGCTGAGC
AACGGCGAGGTAGTGGCCTACGACCTAGATCGTGAGCGGCTGTCACCTCTACGGGTGCCGAATCTGTGGCGGACGCGACC
AGACGCGACAGACGTCGGGCGAGTTCGGGCTCGTCCGGCCACGTCGTCGACGATGGTGACGGCGTCGATGGGACTCGTGT
CGCTGCAGCTGCACCCACGCGATGCCGGCAAGCTGCTGGTGGGCTACTCGAAGGGCGCGGTGATCTACTCGTTCAAGCAC
GAGCAGGCAACGCGGTACTTTGAGTACGTGGTGCCGGCCGGAGCACCGGGTGGCAACGGCGAGACGCCCGACGTGGAGCG
ACGGCCACGGCTGATTCAGGCGCTCTGGCACCCCACAGGCACGTTTGTGCTGACGGCACACGACGACGGCAGCCTGGTCT
TCTGGGACCCCAAGGACGGCCGGGTGGTGCTGGCCCGGTCACTGTACGCATCCGGGGTGGATCAGGCCAGTGCTGGGGGC
CCGACGAAGCCGCGGCTGCTGGATCCGTTTGTCAAGATCGCCTGGTGCTGCAAGAAGAACCCGGATGACACGGCACTTCT
GGTGGCCGGTGGGCTGGCCTTTGACGCGCCCGAGAAGGGACTGACCTTTCTGGATCTGGGCCCGACGCCGGTGTATGCGA
CGTCGTCGTGGCAGATGCTTTCGGACCATTTCCGCGGCAAGCGCCAGCAGCTGCTGCCCATTCCACCGGGCACCGAGATC
AGCGGCTTCTGTCTGGCGCCGCGCTTGACGCCGCACTTTGACGGTGCCAGCGACCCCATTGCCGTCTTCACGCTGCTCAG
CTCGGGCGAGATGCTGACGCTGAGCTTCCCATCGGGCTTTCCCATCAGTCCGACGAACCAGCTGCACCCGTCGATCTCGT
TTGTGGCCCCGTTCGTGTCCCAGTACGCCGTGGCCACCATGGCCCGTGACCGCTGGCTGGGTCTGACCGAGACACGCAAC
ACGGGCGAGCCGCTGCTTCGGGGCGGTGCTCCGGCACCGAGGCCACGGCGCCGCTACGAGCGTCGCAACATCTTGCAGAC
CGCCCACGCCGACGGCACGGTGCGCATCTGGGACGCAGGCCACGGCGACGAGATCGAGAACCCGGCTGTGCTGCAGGTGG
ACGTGGCTCGGGCAGTGGCGCGCGATCGTGACGTCGAGATCACGGCGCTGTCGCTGGCTGCAGTCACGGGCGAGCTGGCC
ATCGGCACGCGGGTTGGCGAGGTCGTGCTGTTCCGCTGGGGAACGAACCGGACGTTTGGCAGTAACAGCGGCGACAGCAA
CAAGACCAATGCGGGGCCATCCAACCCGGGCGGCTTCACCGACATCAGCAAGCGCACCGAGGACTCGCTGCAGGACGGGC
TGCAGCCGTGGGTTCTGTACGAGATGCTACAGGGGCCGGTCAGCATGGTGGCCGGGTCTGACGTCGGCTTCGTGGCGGCC
GGGTCCGAGAACGGGTTTCTGTCCATTATCGACCTGCGCGGGCCGTCACTCATCTTCCACGGCGCGCTGGCCGACTTTGC
CAAGTCCGAGAAGCGGTCGTCCTTTCTGGGCGGCCGACATGGCAGTGGCAGCAGCAGCAGCGGCCAGAAGAAGGATTACC
CGGTCGTGGCTGAGTTTGCCGTGCTCTCGCTCGAGGGCAAGTCCTACTCCAGCCTCGTCTGTCTGGTCGGCACGCAGCAG
GGCAAGCTGCTCACGTTTGAGCTGCTGCCGTCGGCTGACGGCTACACGGCCAAGCTAGCCGGCATGACCGACCTCAAGGA
CAAGATCGTGGCCATCTGTCCGATTGTGGCCGACACCGGCGTCTCGGCCGTGGCAACAGGCGCAGCCGTGGCTGGTCTTC
GCAGTGGACAGCACGTGAATGGGACTTTGGTTGTTGGTGAGTGTGTTGTCGTCTGATCTTTTTGTTTTTGTTCATCCGCC
CTAACACGTACAGCCACCCAAAGCGAAGCTCGCATCTTCCGACCAGTAGCTGCCAAGGGCGCATCCAAATCGTTTGACGA
TGTGTTCTGCTACGCAGCTGAGGTCGTCCACAACGAGCTGCACGGACACGCGCTGGTAGGCATGTTCGGCGACGGGACCA
CGCGGGCCTTCACGCTACCGGGACTCAAGGAGATCAGCCGGGCACCGCTGGCGCAGCTGGATGCCGCACGTCTGGGCGAT
GCCGTGGTCTCGCCGAGCGGTGACATCTTTGGCTGGACTGGGCCATCCGAACTGGTCATCGTATCGTCGTGGGGTGCCGT
GCGAGGTCCAGACGGGCCGGGCGATACGCTCGTCAATCCAGACCTAGCCGTGCCGCCGCGTCCGACCATTAGCAATCTGC
AGTGGATCTCGGGCACGCAGTATGTGTCGCCGCTAGATCTCGACCTGCTGATCGGCGGACCCGACCGGCCGCCGAGCAAC
CGCATGATGGCAGCCGCTGCTGAGGAGGCTCGCATCGCCCGCCATCAGGGCGCTACTGGAGCCGGTGCACCACCCGGACA
GGCCGGCCTACAGAGAGCCGGCACCGGCCAGGAGGGCTGGGGCCAGTACCTCTCGCGACAGTTCAACGAGCGGACCGAGA
AGCTGACATTTGTGAGCGACGGCATGGACAACCTGCAGGAACAGAGCCAGGGCTGGGCCGACGACGTCAGCAAGTACGTG
TCGAACCAGAAGCGCAGCCTGGTCATGGGCGCTGTCAAGAGCAAGTTCTTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62