GenePrediction:GLEAN_1452 Details

Name: GLEAN_1452
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:560965..562063 (+ strand)
Length: 1099
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:560965..561534 (+ strand)
Length: 570
Type: CDS
Source: GLEAN
Position: GCSC_168:561680..562063 (+ strand)
Length: 384
>GLEAN_1452 class=GenePrediction position=GCSC_168:560965..562063 (+ strand)
ATGTCCACGATCGCCTCGCCGCGCGAGCCGCCGCCGCTGCGGCGTATCCCTTCGGCACAGACGCCGACGTCGTCGACGCG
GCCGAGCATCGAGATCAGCCGGTCCGTCGCCGGTTCGCCCAACCCCAGCATCACGGGCGCCTCGTCGGCCGCTTCGGCTG
CTTCGACGACGGCGACACCGTCGGGACTGATGTCGCCGGCCAGCGTCACCACCGCTGCCGTGCGCCGCAACCGCGCTGCT
CTGCGCGAGTACTACAATATCCACAAGAACGGCACGGCCACGCCCGCCCTCGAGGTCACAGACGTCGACCTTGCACCACG
ACAACAACAACAGCAGCTCGGCGGTAGCCTCTCGGCATCTTACTCCGAGGTCACACCGTCTGCCATGGACCGCCCCGACT
TTGACGCCGTCGCCTTTGTGCGCAACACCCTGCAGGCCGGCGGGCTCGAAGACCTGCTGCGCACTTACACCCGCGTGCTG
AGCGAGATGCGCGCCCTCGACGCCGAGAAGAAGAGCTTGGTCTACGACAACTACAGCCGCCTGATTACGGCTACCGAGAC
TATCCGAAAGGTTTGTTTTCTTTCCTCGCTTCGCTCGCTTCTCCCTTCTCCGTTCCTCGCCTCACTCATCTCTCTTTTCT
TTCCTCGCTTCGCTCGCTTCTCGCTTCTCGCTTCTCCTCCCTGTTCCTCGCTTCGCTCGTCCGCTAATCCTCTAGATGCG
TGCCAATATGGACCCCCTCAATCCCATGGCCTCCACCCTCGATCCGGCCATTGCCCATATCTACAGCCAGGCAAAGGCCC
TCTGCGACGCTATGCGTCAGTCTGTGCCGGCCCCCGATACCCCCGACGCCGCAGCCTTTGCCGCTCGCGCCCGCACTCGC
CAGCTGGCTGCCGCCGTGCTAGAGACCCCCGACCGGCTGCGCCAGCTCATGCGCGAGGGCCGTCCTGACGAGGCCAAGGC
CGCTTGGGACCGGCCCCGCCGTTTGCTCGAGCTCTGGCGCGCCAAGGGCCTCGGCGGTGATGATGTGGCTGCCTGTCTCG
CCGACGGTGACGCTGCCCTGCGTGGCGAGCAGGCGAGCCCGAATGAACTAGTCACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62