GenePrediction:GLEAN_1458 Details

Name: GLEAN_1458
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:592426..595896 (+ strand)
Length: 3471
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:592426..593217 (+ strand)
Length: 792
Type: CDS
Source: GLEAN
Position: GCSC_168:593286..594759 (+ strand)
Length: 1474
Type: CDS
Source: GLEAN
Position: GCSC_168:594809..595896 (+ strand)
Length: 1088
>GLEAN_1458 class=GenePrediction position=GCSC_168:592426..595896 (+ strand)
ATGGCCTCGAGCCTTTCCGAAACAGATGCTGCCCAGCAGGACGCAGCTTGGGCAGAGAGTACTGGTGATGAGACGGCTGG
GGAGGAACAGATCCGGCCTTCTGATAGGCCGCTTAGCGACAGACAAGATCAAGATCCTGATGATTCTGCTGCTGCAGACA
CTGATGTCTCTGGTGACTTTCCTTCTCATACCGCTGGTGCAGATGGCTCATCTGAATACGATCCCGGGGCGGTGGTGGTG
CCGGCTGTAGAGGCCGTCTTCGATGCTGAGCCCGAGGCTGTCGCCACTGGCGACGAGTCAGCAGAGCCTGAACGCGTGCC
TGTTCCCGCGGCGAAGAAGCCCAAGGCCGTTGGAGGCTTCTTGGTGGGAGACTCGGACTCGGAAGACGACGAAGACACTC
CTGCCGCTGCCGCTAACGGCCAGTACGGTCTTGCATACCCTCTTCCTCAGGGCGACGGCCAGTCATCCCTTAATGCCCCT
GCCTCTGTGCCGGATGCCGATGGCAATGATTCATATGACCCTTCTCTGTCCACGCAAACAACGATGGCTGGCGTGCTGAC
GGTACCGATACCAGCACCTGCACCTGCATCTGCACCTGCACCGCAGCCGGCTGCTTTCCCCTCCTCCGCTGCTGTTCTTG
ATGCTGGCGGCCGTCTGGAGGCGCGTATCGCTGACGATCCGCGGGGATCTGTGGACTCGTGGCTTGCCCTGATTAGCGAA
TATCGCCAAAACAACAGATTCGAAGATGCCCGATCTGCATTCAGGCGCTTTTTGGACGTCTTTCCCCAGGCTGTATGTCT
CCCCTGTCTCCATCCCGGTTCTCTTGTCTGCCCTTCTCCCTGACTTACATTGTACAACAGGCCGAAGTATGGATCGACAA
CATCGAAATGGAGCTAGAGCTGGACAACTTTGCTGCGGCCGAGGACCTCTTCGCCAGATCGCTCACCAAGGTGCTCAACG
TCCCGCTCTGGGTGGTGTACCTCGACTACGTTCGCCGACGCAACAACCTGCTAGGTGACAACGCCGAAGAGGCGCGGAAG
GTCGTCAGCCGGGCATACGAATTCGTTCTCGACAATGTCGGTCTCGACAAGGACGCCGGGAGGGTCTGGCAGGATTATGT
GCAGTTCATCCGCTCGGCTCCGGGCACGATCGGTGGTGCCGGCTGGCAGGATCAACAGAAAATGGACCAGCTGAGGAAGG
CCTTTCGACGGGCAACCTGCATCCCCATATCCAACGTCAACCAGCTGTGGAAGGAGTACGACCAATTCGAGATGGGCCTC
AACAAGATCACTGGCCGCAAATTCCTGGCCGAGCGATCGCCAGCCTACATGTCGGCCAAGAGCGCCAACACGGCATTGGA
GAACCTGACACGCGGCCTCAGTCGCACCACGATTCCCCGGCTGCCACCGCTCGCAGGGTTTGACGGATATCCGGAGTACA
TGGCGCAGGTGGAGCTGTGGAAGCGGTGGATTGCGTGGGAGAGATCGGACCCTCTCGACCTCGGCCCTGACGAACCGGAC
GTTCTGAAGGCGCGCATTCTTTACTGCTACAAGCAGGCTCTCATGCCGTTGCGGTTCTGGCCGGAGCTGTGGGTTGAGGC
GGCCGAGTGGTGCTTCGCCAACGATGTGAAGGAGTCTGGAAATGACAAGGGCATCGATTTTCTTGTCGATGGCATCGCGG
CCAATCCCGAGAGCATCCTGCTGGCCTTGAAGCACGCCGACCGCATCGAATCGACGTATCCTGTGGAGGAGGGTGACGAA
GCCAAGATTGCCCGCGGCCTGGCCGTGCGAGTGCCCTACGACAAGATTATACAGACGCTGCGCGACCTACACAAATCTCT
GCAGGATCGGGAAAAGGCTGAGATTGCACGGTTAGAGGAGGCCATGGCTCCCGCCGGCACACAGAACACACAGAACGATG
ACGACTATGGGAACGACGAGGACGACGAACAACAGGGGGGGAATGGGCACGCTGGTGACGAAGAGCGGGAAAGGAAGATC
GCGTTCACCCGGCAGGCCTTTGCAGCACAGATGGACCTAGTGTCGAAATGTCTAACGCACGTCTGGATTGCCCTCGCGCG
CGCGATGCGGCGGATACAAGGCAAAGGCAGCCCACAGGGCCCGCTTGGGGGTATGCGCCAGGTGTTCTATGAGGCTCGCA
AAGGAGGACGTCTCAAGAGTGACATTTACGTTGCCATTGCCAAGATGGAGTGGAAGTGCTACAACGACAAAGCGGGCGGC
AAGATTCTGGAACGTGGGTCGAAGTTGTTCCCCGAGGATGCATACTTTATGATAGAGTACATCAAGTACTTGATCGCTCA
TGGCGACAACACAAGTAAGTGGCCGCTCTCCTTCGCTCTGTTTGCGTTTGTCTGACACGATAGACTCGCGAGTCGTGTTC
GAAACGTGTGTCAACCGGCTTGCCCAGAAGCCGGAAACGGTGCACAAGGCCAAGCCGCTATTGGCTTACATGCACAAGCG
AGAGGCTGAATACGGCGACCTCTCACGTGTGATTGAGCTGGAGAAGCGCATGGCAGAGCTGTATCCCGACGATCCGAAGC
TGGCCCTGTTCAGCAAGCGTTTCGCGACCGAGAAGTTCGACCCAGCCGGTGCCCGCATCATCATCTCGCCAGCCGCACAG
CTGCGTCCACCTCGCGGTATCATGCCGTCAGTAGAGAAGCCAGCGTCTCTTCGCAACAGCCCCATGCCGGGTGGCCTGTC
TCTGCGACAGCCTAATAGCCCACGCATGAGTCTCATGGCAGCCTCCACGAACTCGCCGAAGCGGCCGTTCCCGACGGACG
ACTTCGACGACAGCAACCCGCCCCGGAAGATGCTCAGGGGCGCCGACCAGCGCGAATTTGTGCGAGGCGAGTCTCCTCTG
AAAGGAGCGGCCGGACGACGTTTGGACCAGCAGCGCCGACTGCACGGCCAGGGTTCCGGATACGGGGCCATGTCCTCGGC
TGCTGCTCCGCCGGCTCCTCTGCCAACTATGGTGACCTTTTTGCTGGGACAGCTGCCACCGGCTGCGCTGTACAATGGCA
TACGCTGTGCGCCCATTGGCCTGGTGCAATTGCTTCGGGAGACCGATATTGACCCCAACACCTGGGAGCCCGGCCGGAAG
AACGCCTCGAAGCAGGCAAGACAGCAATTTGGTCGTCATGGAGCCGGTCCAGGACACGCTCGTCAGGTGTCTTCTGACTT
TGCCCACTACCGCGGCAGCCGGAACTCGCCGGCTCCTTCTGGAGGGTATCGGCAGCCGTCTCTGCGGCCGGACGAGGCAT
ATGAGCCGCCTCCGCCGTCGCTGGGAGCCGTCCCTGCCGTTTATCCAGGTCAGTACGGAGCGCCGCCACCGCAGCAGTTT
GAAGGCGGCCAGCAATGGCCGGCAGCAGCGCCACCTGCGGGCTACGGCGTTCCGTCGTATCCGCAGCAGGCGCCGCCACC
GGGCCAGTACGGCAACTTTCGGTATCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62