GenePrediction:GLEAN_1459 Details

Name: GLEAN_1459
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:597449..600570 (+ strand)
Length: 3122
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:597449..597703 (+ strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_168:597771..597893 (+ strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_168:597958..598082 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_168:598137..600570 (+ strand)
Length: 2434
>GLEAN_1459 class=GenePrediction position=GCSC_168:597449..600570 (+ strand)
ATGGATCCTGGCCCATCGCACAGTCGCCGTCCGTCTCAGGGCGGTTCGAAAGTGGGCGGACCTTCGGACGGTTCTCCTCA
AAGCCGCCGTCCCTCTGTCAGCGGCTCTCAGCCTCCATCCCCCGGGCCTGCCGCCCAAGGACAGTTCCCTCCGGGTCTTG
GATATGACCCAGCACGGGCTCCTCTTGACGAGGCCAAGCGCAGGGCCAAGGAGATGCCTTCACGCATCGACCTGCCCGCA
GATGCGTACAGCCTGGTGAGTTTAAGTCGGGGTTTTTAGTCCTTCTTACACCGTGTATATTAACCTGTGTGTTTAATCGT
AGGCTAAAATGCCGACACCGTATGCTCGTCGCCCTGGATACAACACCGTCGACAAGCCTGTGAATCTTAGAATCAACCAG
TACCGCGTTGAACAGGCTGCGAACATCAAGGTGTTCCAATACGCAGTAAGTACCTATATCCTATTTGAACTCCCTCTTCC
TATTATCGCCTTCTAACAACTTCTTCAAGTTCACGGTCAAGCCAGAGCCGCTCAAGAATGTTGTCTACAAGAAATGCTGG
TCCTCTCATAGATTTCAGCAGAAGTTGGAGAAATACAGCAAGTCCTGGTTGTATGATGGGAGAAACCTCGTCTGGTAAGC
TTGCAGAGCCCCCCGCTGTGATTCTTCTCCAGTAGCTAATTAGATTAGGTCGATCAATGATATGAAAGAGCCCATCCAAA
TCGAAATCGATCTCGACGAGGAAAAGGGGCGAGTGCCTCGACCCGGAAAAGAGGACAAACAGTTCATTATCCTCAAGCAA
ACGAGCACGATTTACCTCTCGTCTCTAATTGCGTACCTTCGCGGTACAGCTAGCTGGGACACCCATGTGCTCGAATGCAT
GAACTTTTTCGACCATGCACTGCGTCAGAAGCCTAGCACATACATGACAGCCATTCGACGGAACTTTTATCACCCCAACG
CGCCTCGCCGGGATCTTGATGGCGTAGTGTATGCTGCCAAGGGCATCTATGCCGCATTCCGACTGTCGGAGTCCATCCGG
ACCGGCGGCTCCGGCCTTGGCATCAATGTTGATGTTGCCAACACCACGTTCTGGCGAGAACAGACATTGGACAATCTTGT
CATGAAATTCTTGAATACAGCGGGAGAGAAGTGGCACGCCAGCAGCCATCTGGATGCCATGAACCTCCTGAAGCCAGTTC
AGTCCAAGTTCAACTTGAAGCTCAAAGAGGCTGCAAAGTCTGATGCATTCGTCAGCCTGCGCAAGCTGCACAAGCTTCGC
TTCAAGGTATTTCATCGCGGCAAGACAAATGATGAGAAAACCTATTCCATCGCTCGCTTCGCCTGGGATTCCAAATACCA
GTTTGAGGGCGCCACTGCCAGAAATGTGACTTTCACCAACAACAAGACTGGAGAGACTCGAAGCATTGCCGACCACTACT
TGAAGCAGTATGATATTCATCTTCGCTACCCCAACTACCCGGTGGTCGAAACTCTTCGCGATGGAGCCTTCCCTTTGGAA
GTCTGTCAGATCATTCCCTGGCAGCGGTATCCTTACAAGCTGACGCCCGCCCAAACATCTGACATGATTCGATTTGCTGT
CACTCGCCCGGCCGAGCGTTCGAAGAGCATTGCAGAGAATGTGGCCAAGCTTGGATGGGGAAGTGACGAATATCTTCGTG
ACTTTGGTATTCGCGTCAATCCCAGCATGACTCAGGTTCAGGGCAGGCTGTTGCAGGCTCCCAGTGTGGCCTACAAAAAC
GGAGTTGCCAAACCAGGCACGACCGGCCGCTGGGACTTGCGCCAAAAGATCTTGCACATCAACAACAAAGATCGCCCGCT
GACCAACTGGGGTTTCGTCATCGTTGACAACTGCGTCGACATGGCTGCCGCGAGCAACTTTGTCCGTGTTTTCACAAAGA
CATACAAGGATCACGGTGGGTTGGTGACAAAGCCGCCGCATATGACCAGGTTTCCGAGAGACAAGCCTCTCGACGAGGTC
TACTTCGAAGCGTACAACGCAACGGTGAATGCGAATGGCGGCCAGCATCCGGTGATGATGTTTTTTGTTCTCCCAACCAA
GAATGCTTTCAGCTACTACCGTCTGAAGAAGAGTGGCGAATGCCGCTTTGGAATGGTCTCTCAGATGGTCGGGTCTCAGC
ACGTTATGAAAGCCCAGCCTCAGTACTGTTCCAATGTCTGCATGAAGGTGAACGCCAAGCTTGGAGGAACAACCTGTCGT
ATTCCGAAAGAAGGGAACGCTACCCGTCCGGCTTTCTTTGAGGCCCCGACCATGGTCATTGGTGTTGACATCTCTCATGG
TACCACGAACGTCAAGGGTGAGTTGGAGCCGTCGATGGCGGCCATGACTGTTTCCTGGGATCGAGATGCTGCCAAGTACG
CCGCATTTTGCCAGACCAATGGCTTCCGCACGGAAATTATCAGCCCTCTCAAGATGCAGGGCATGTTCAACGATGCTTTG
ACCAAGTGGCGCGAAGCTTTGAACTGTCGGATGCCAGAGCATGTCTACTACTTCCGCGACGGTGTATCGGAGGGAGAGTT
TGGCCAAGTCATGGATTTTGAGATTGCCGAGATCAGAAAGATCTTCCGCGAGCGTTGTGGCCAGGTCCCTAAATTCACCG
TCATCATCGCTACCAAACGCCATCACATCCGTTTCTTCCCCGAAGGCAGCAGTGGAGATCGCAATGGCAATCCGCTACCG
GGAACCGTCGTTGAGAAGGAGGTCACACATCCCTTCCACTATGACTTCTATCTCTGCTCTCATGTTGCAATTCAGGGTAC
GGCACGCCCCGTTCATTACCACGTCATTCACGACGAGATCAAGCTGGAGCCGCACAAGCTGCAGAAGATGATCTATCAAC
AATGCTACCAATACGCGCGGTCTACGACACCAGTCTCCCTGCACCCGGCTGTGTACTATGCTCATTTGGCTGGTGATCGC
GCTCGCTCGCACCAAGACATCCAGTCCGAGAAGAAAGACCCTGTGCATATCCAGAAAATGATGAACAACTGGTCCGCAAA
GAATACGTCGAGCAACCAGACGCACCCGACGGGAGGGCGCCACCGCTTCTCCCTTTTGGCACGAGTATCGCCGCAGACAT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62