GenePrediction:GLEAN_145 Details

Name: GLEAN_145
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:989545..991645 (+ strand)
Length: 2101
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:989545..989752 (+ strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_179:989806..989938 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_179:989987..990324 (+ strand)
Length: 338
Type: CDS
Source: GLEAN
Position: GCSC_179:990392..990507 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_179:990574..990717 (+ strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_179:990775..990940 (+ strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_179:991067..991316 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_179:991386..991492 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_179:991554..991645 (+ strand)
Length: 92
>GLEAN_145 class=GenePrediction position=GCSC_179:989545..991645 (+ strand)
ATGGACGTCTTCAGGCTGCCAACACCCACGGTCATCGGACTTGTTGGAATACTGGCTCTCGCTGTGGTCTACCTTAATCC
CCGCGTATTTGGAAAGCGCAAGTATAATTTTCCACCTGGCCCCCCTGGCGAGTTCCTCCTTGGGCACTACCGAAAAATAC
CATTCACCGCCCCGTTCAAGCAGTACGCAAAATGGTCAAAGGAATATGGTATGCACCGCTTGTTGCAGTAAGAACGAATT
TCTGCTAAAGTGAGCCCGTAGACTCCGAAGTCCTCTATTTTGAGACGTTCGGTACAAAATGGATTGTCCCAAACAGTCTT
CAGTCTGCGATCGATCTTCTGGACAAGCGTGGAGTGAACTACAGCGACAGGCCTAAATTCATCTTGTTTGAAGAGTAGGA
GCTACGACCCTAGAGTCAAGGTTTGGAACTGACGACTTGCAGGATGGGATGGGCCCCGACCCTGACATGGCTCCGCTGGG
GGCCGCAGATGCAGCGCCATCGCAGGGTTCTTCAGCCGGCCTTCAGCAAGACACAAGTCCGTCAACATCAGGACAGCCAG
CAGAAGGAAGCTCTTATCTGTCTGCACAATATTTTAGACGACGCCGAGAATTGGACTGGATCTATTCGGCAGTTTGCCGT
TGCCATTGTGCTCAACATTGCCTTTGGCATTGATGTCGATGGTCCATGTAGTCCGTGGATCAAGACTGCGGACGACGCTG
CTGATGCTATCGGCCACTCCGGTGCACCGGCAAGAAGTATCGTGGACCAGTTTCCAGCAAGTAAGTAACCCTGCTTTCAC
CACTGTTCTGCGCCAATACAATTTCTCACAATAGGTCACAATCTTAGCGCGCCATCTGCCTACCTGGCTTCCATTCATGG
AGCGACTTCGCTATGCCCGCAACCGGCGATGGGCTATTGAGGCCATCACGAACATTCCCTTCGCCCAGGCCAGGAAAGAA
GTTGTACGTTCAGTCTACACTGGCCTGAATCTGGTACTGGGGACTTCCATACTAACTTCTTATTGATAGGAAGAGAAAAT
ACACAAAAAGTGCTTTGCTCATGACCGCCTTCACGTTTACAACCACAACGTCGTTAATGGGGTCGAGAACGAGTTTACGA
TGGACGATATTCGAGGATCGTCTGCTGCAATTTACATTGCGGGAAACGACACGGTGAATTCTCGTCGCCGTATCGCACGC
TGTCTCAGCTTATTCTAACTTTTTAAAAAGACTGCTACCACTGTTATCCTCTTTGTCCTGTACTTGATGCAGAACCCGGA
TGTTCAGGCCAAAGCCCAGGAAGAGATCGACCGGGTGGTCGGAAATGAGCGGCTGCCTACTTGGGAAGACATCTCCGACT
TGCCGTACATGAACCTCGTCTTGCAGGAGACGTTCCGTATGAACCCGTTGTCGCCTCTCGGAATTCCACATGCCGCCGTG
GCAGATGACGTGTACAACGGAATGTTAATCTCTGCAGGCACGATTGTGTACTAAAACGTCTGGGCCATGCACCATAATGA
AGAAATTTATGCGGAGCCGTTCAAGTTCTGGCCGGAGCGATATCTTGCAAATAACGAAGGCGGCAATGGCGAGCCACTTC
CAGTAGGAAACTTCGGCTTTGGCCGTCGTGTCTGCATTGGGAGAGCCTTGGCTGAGAACAGCTTGCTTATCGTCCTGGCG
AGTATGCTGGCGACCATGAAAATCGAGTTCCCACTTGACAAGAATGGGGATCGCACTCTATTTGAACCTGAATGGCCATA
CTTGGGACAAGCGTATGTGTTCATTCCGGTCTGGGTTTTTTCATGTGCTAACTAGGCTACAGACAACCACTGCCCTTCCA
GGCCAGTATATCCCCCCGGTCTGCTAAGATGGCAGAGCTTTTACGAGACGCAGCAACTACTGCGAAAGCCTGAAGTCGAG
GTGTCCATCCGCTATCGTGTCGGTCATCGTAAGTAGCGAAATCCGAGGGCTCCTGCAGCTAGGCCTGTTAGCTGTCGGAC
AACGCGCAGGTGTACAGCTGCGGAGCGCCAGGGAAGAGGCTGCTGTTGACAGTGGAGAACGTGGAGTCAAGCTGCCGAAG
AGTGGGATCATGATGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62