GenePrediction:GLEAN_1460 Details

Name: GLEAN_1460
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:608513..610691 (+ strand)
Length: 2179
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:608513..608588 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_168:608661..609193 (+ strand)
Length: 533
Type: CDS
Source: GLEAN
Position: GCSC_168:609258..610691 (+ strand)
Length: 1434
>GLEAN_1460 class=GenePrediction position=GCSC_168:608513..610691 (+ strand)
ATGACTCAATTTGAAGGACAGCCTAAGGAGCTCGATGCTGGTGATAGCCTGCCATCGAGGGAGCAGTTTTGGGAAGGTGA
GTGATGAACCTTGCTTGTCCAAGAAGGCAGAAACTGATAGGTGGACCCTCGGTCCTCTCTCGGTACAGAATTGAACTACG
CGCTGTCTACTCCGTGTGCCAGCTACGAACTAATCGATAACGCCTTGCGGGCCTGGCTCGAACTCGTCTCGGCATGTCGC
GACCGGTATCTTGAGGAGGAAGAGGATCTCGCGCGGTGTTCGCAGAAGCTGTTGACCAGTACGATATTTGAGGCCCACGG
CGCATACGTGCGCACGCAGATCATATACAGCCTGCTCCAGGAGGATGAGGCACGGTCGCTGCATGTGATCGCCAACTTCC
TGCTGCTGGACGGACGGACACACGAGGACGTGTTTCAGGAGATGATCAATGCCGGTTGCTTCACGCGACTGGTCGAGCTC
ATCAAGACCAGCCCCGACGACGACCGACGGCTACACCGACTGCTTCTCGAGCTGATGTACGAGATGTCCCGCGCTGAGCG
TGTGCGCACAACCGATCTGCTACATGTGGACGATGCCTTCATTGGCTGTCTCTTCCAGATGATCGAAGACCTTGCCGACG
ACTTTGACGACCCATACCACTACCCTGTAATCCGTGTATTGGTGAGAGCACATCGCGTCCCCATCTGCCGTGCGAGCAAG
CATTGCTAATTGCCGCGGGATTTAGCTGGTCCTCAATGAGCAGTATATGGTGGCAGCCACGACGGCAGCCACGACGGCGG
CCGTTGACCTTGTGTTACCGGTCGCGCCACTGACCAACCGTGTCATCAAGGTTCTCAGCCTTCACGGACCGTTGTACCGC
ACGTTTGGCGAGAACATCATTTTGCTGCTGAACCGCGAGACCGAGACGTCGCTGCAGCTGCTGATCCTGAAGCTGATGTA
TCTCCTCTTCACAACAAAACCCACGTACGAGTATTTTTACACCAACGACCTGCGCGTGCTGCTCGATGTGATCATTCGGA
ATCTGCTGGATCTGCCCGACGAGCTGACGACGTTGCGCCACACGTACCTGCGCGTGCTCTATCCGCTGCTGGCACACACG
CAGTTGCAACAGGCGCCACACTACAAGCGGGACGAGATCCTGAGAGTGCTGGCGATTCTCAGCGGGTCTGGAAATGCTCA
CTTTGCGCCGGCAGATGAGACGACGCTGCGGCTTGTAGACCGCGTGTCCAAGGTCGAATGGTTGGCCACCACGTTGCTGC
CGTCCGCGCCCGCTTCACCGTCGAGTCCTACAAATACAGTGGACACGATAGACACGACGGACACGACGGCAACATCCAGC
ACGGCAGCGACCGTGAATTCGATCGGCACGGCTGACATCTTTGACACCATAGACACCGACACCGACACCAGCGATGCCGG
TTCTATCAGCACTGACAGCACGGCCTCCGTGAGCAAAACGGCGAGCAACGCAGGACCCTCCGTCGACAACGGCAGCCAAA
TGATCAACAAGCTGCTGGGCATCAGCCTCTCGCACGAAGAAAGCTGCGGTAGCGTTGTGAACGTGGCTTCCGTGAAAGAG
AAGCCCGGAGTCAAGACGCCCAGCCGTAAAGCCGATATGCCGCAGACAGGTCAGTATGGGAACTCGAACGGGACGACAGA
GCAGAGTCACAGCGGTGAGCAACCAGAGGAAACGACACTACACGCCCAACGCGGTCATACGCCACAGGCTAGACCGCCGC
CGCCACGAACAGCATCCCGTAACCTGCCCCGAGCACCGCCTGACACATCGCCTAAAACAACATCGATTTCGCAAGAACAA
CAATCTCTGTCCGGGAACGGACACCAGGACCATAAACGACGGCAACGGCGCGCTCTTCCGGCTGTGCCAAGGCACCGACA
TGGCGTGTTGATGAAGCCAACAGGCGATCTGACACCTGAAGCCGCATCCGATGGCAGCAACAGCATGAGTGCTCCCAGCG
TATCGACTACCGGCACCACTCTGACATCAGGGCACGGCGGCATCAAGAAGCTGGCTCCCAAGGCGCCACCAAAAGCACCA
CCACCCCGCCGGATCGGCAGGCTGCGGCAGGCATCCGTGTCAACCGTAAGTCTGCAGTCGACGATTGATGCAGTCGTGGA
ATCGAGCTCATCGTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62