GenePrediction:GLEAN_1461 Details

Name: GLEAN_1461
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:612652..614782 (+ strand)
Length: 2131
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:612652..613136 (+ strand)
Length: 485
Type: CDS
Source: GLEAN
Position: GCSC_168:613371..613493 (+ strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_168:613558..613848 (+ strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_168:613922..613945 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_168:614002..614782 (+ strand)
Length: 781
>GLEAN_1461 class=GenePrediction position=GCSC_168:612652..614782 (+ strand)
ATGGACGGCTTCAGTTTCAAAGAAACTGAAAAGGGCCAAGCGGCGTGCAGAGCCGACAGATGTGACTCCTTACCTCCAGA
TAGCCTGAAAGTGGATCAAGAACGCCTCAGAACAAGTAGTGAAAGCCTTCGCGGCCATGAGACAGACGACTCCGACCCGC
TTGAACCACTCGAGCTTGCTCTCACACCAAACCTGGAGACCCAGGATGAGATTGACGCGCGCGTACCCATCTCGCATATC
GGGACTGCATCGAGTGTCGGAAGCTCAGCCTCGCGTCCTCCCAGCTACGAGGTTATCTTTGGAGAGGGGGACCTCGATAA
CCCGCGAAACTGGCCGTCCTGGTACCGCTACTGGCTGATCCTGTGCGTGTCCTATACCACCTGGGTCGTTGTCGTGTATA
GTACCAGCTACACGTCGGCGATTCCTGGCCTGATGAAAGCGTTTAACGAGTCGAGTGAAACTGTGACTACTCTTGGCGTC
ACCTCGTATCTTCTCGGTCTGGCCACAGGAAGCGTGATGCTGGCCCCATTGAGCGAGCTTTTTGGTCGTCGGCCAATATA
TTTAGTCTGTATTATCTGCTTTACCCTGCTGATTCTACCAAGCGCACTTGGAACATCGCTGGCAGGAATCATTGTTGTCC
GATTCTTTGGGTAGGGACATCCTGTTGGCGAAGTCGACCCATACCTGCCACTCGTCGATTGCTCTAACAGTCTGGATAGG
GCGCTGTTCGGAGCCGCGCTGGTCTCTAACAGTCCAGCAACGGTTGTCGACATCTCCAGCGAGGAGTATCGCGCTTTTTA
CATATCGCTCGTGTCGATTGCGCCCCTTAATGGCCCGGTGACGTAAGCCATACTTGCAGGTAGATAGTCCTGAATTAAAC
ACTTGCTGACTACAGTGCACCGACAGTGGACCAGTTATAGGTGGCTTTGTGTTCGAATACCTTGGATGGCGATGGGACAG
CTGGATCGTTCTGATCCTCGCCGGCGTTGCTATTGCGCTTATGTTCACGGTAAAAGAGACCTATGCGCCTGTTGTTCTCA
AGGCAAAGGCTGCTCGCATCCGCAAAGAAACAGGAGATGACCGGTATTGGTGCCGGTACGACCAGAAAATATCGATACCC
CATCTCCTAAAGATCAACATGAGCCGGCCGTTCATCCTCAGCTTCACGGAGCCGATCTTGTGGTTCTTTAATATTTGGTC
CGTTTGTACATGGCAAACAAATGTGCTTGCTTATCTTGACGACATCCTGCTGACCATGTCCCCTCTTTAGGATATCTGTT
GTCTACGGTATTCTGTAAGCAGTCTCACGACTCAAACAGGGGTATAGAACAAGAACTCACTGAATTCCAGGTACCTCTGC
TTCGTGGCATACCCCATTGTCTTTCGCAAGCACCGGGGCTGGAGTGCTGGCACGGCAGGTTTGGCATTTGTCGGCATGGG
AACCGGTACGATGCTTGCCATTGTGAGCGAGCCCATCTGCAGAAAGTTCATCAACAAGCACAGGAAAGACCCAGAAACGG
GGCGCGCACCACCGGAGGCATCCGCGCGGGTGCTGATTATTGGCGCCGTTCTCACCCCCGTCGGACAGCTGGTGTTCTCG
TGGACGTGTCTACCGACGACCATCCACTGGGCCATACCGATTGTCTTCGGGATCCCGTTTGGCGCAGGGAACACCCTGAC
CTTCATCTATGGCTCCAATTACCTGGCAGGCTCGTATGGCATCTATGCTGCATCGGCTCTTGCCGGCAACACGGTGATGC
GATCCATATTCGGGGCCACTCTTCCGCTGGCCGGGCCCAGCATGTATGCAAAAATGTCGCCACAGTGGGCTGGCACCTTT
TTAGGCCTGCTTGAGGTCTGCTTGATACCCATTCCGATCGTCTTCCTCCGGTACGGTGAGCGGATTCGGGGACGAAGTCG
GGTTATCCGACAGATGCGGGAAGACAACACCAAAAACGAGAACAAGCGAGTAAAAGAGATGGCAAGAGTGCAAAGAAAGG
AGAAGGAGGCGGATGTTGCTGCTGCAGTAAAGCTGGGCGACGGTTCTGGACCGCTGGAGGCTGTTGGGGCAAGGGACATC
GAAAAGGGAGTTGATGTACAGCCAGTGATAGCTGTAATTGGAGAGAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62