GenePrediction:GLEAN_1462 Details

Name: GLEAN_1462
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:617566..619280 (+ strand)
Length: 1715
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:617566..617608 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_168:617668..617850 (+ strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_168:617912..618769 (+ strand)
Length: 858
Type: CDS
Source: GLEAN
Position: GCSC_168:618832..619280 (+ strand)
Length: 449
>GLEAN_1462 class=GenePrediction position=GCSC_168:617566..619280 (+ strand)
ATGAAGTTTGCCAGAGCGTTCAAGGCCGCCTTGCAAAGCGGAGGTTCGTGAGCGTCGCGTCCCTGGTCAGGCCATTGGTA
TTTTGGTGCTGACTCGTCTCAGACTACCCGGAAGAATGGTGCACAGCAGCGATCCCATATCCGACCTTGAAGAAATGCCT
CAACAAGATTCGAGCCGAGCTGCAAGACCTGGGCCTCGATGCAGACTCGCTCCGACAGCTACAAGAGACCCAGGCCGTAT
TGGCGCATGGAGACCCGATTCCCCTGGCCAAATACAAGCTGGACGGTAAGTTCAAACCCGGTTCTGGCTTCCGATCTTCA
TTAAGCTGCTGACCACGGGCCTGCAGTGAGCGACTCCGACGTCCAGCCACACTTTACGGTATACCTCGATCTCGAGGACG
GCGCCGTTGTGGACGCCTCTCTGTCACCGGCATCCAGGGCCTTTTTGCAAAAACAAGCCGACATTCGCCGCAAGGCTGTG
GCCGATTCGCAAGCCGACCAAGACCATGATCGCCCGGCATCCGACGTGCTACCGATGGAACCCCCGAACCACAGCACCGA
GGCCAGCGTGGGCCCGCCAACGTGCACAACCGCACTGGCATCACCAGGCCACGAGCAAGAGCTGGACGCTGCCCAGGAGG
GCGGCCAGAAGCGGCTGCAACGCGTCGAGGTGTCGCTCACGGCCGACGGCGAGTTCTTCCGGCTCATGTACGAGGACATG
GCTAAGCTGGAGCGCATCGGCCAGGCCGAACAGGCTGCCATTGTGACGGACGTGGAGGAGCTGGGCAAGCAGGTGGCTGC
GGTGTCGCAGCCAGAACGCAAGCGGCGAACGCTGCTGGGCCACGGTCACGGCCACGGCCATGGGCTCGACGGCACGTCGG
GTGGCCAGGCAACCAAGGCGGCCAAACCGCACAAGCACGCCAGCGACCTCTCGCGGTGGCGTTCAGTCTTTGAGCTGTAC
TTGGATGCTCAAGTTTTTTTCTCGACGCGGGAGCGTGATCATGGCAAGGCGCGTTCGTCGGCCGAGGCGTCGCGCCAGCT
CGACTGGTTCCAGGAACAGGTGCGGAAGCGCGGGCTGCTCCAGAGCTTCCAGTTGCCAGCAAGCCTGGTGGCGTACCAGC
GGTTCCTGCTGCTGAATAAGCGACTCTTTCTCAACCTGCGGTTCCGCGAGCTGAACCAGACGGCCCAGGCCAAGATCCTG
AAGAGTGAGTCCAGTCCATCCTCCACCAAGACTGCACCCAAGGGGCCGGCTCGCTAACACAGCCAGAATTCGACAAGTGG
ACGTCGCTGGGCGTATCCAAGACGTTTCCGAACGCGCTCTCGCGGCGACATCAGAACGTCTTGGTCGAGGGCATGGCCAA
GGACGTGTGTGCGCGCATCGCACAGGACGTTGTGGCCGTGGTGCCACGGCTGGAGGACTACACCTGTCCGGTGTGTCTGA
GCCTTGCCTGGCTGCCCGTGCGGCTGCATTGCCGCCACGTCTTCTGCGTGCGGTGCGTGATCAAGATGCAGCGTGAAAAG
CAGCGGTTCTGTCCGCTATGTCGCGGCGAGGTCGTCATGGAGGCCGACCTGGACAATCTGGACGGGGATCTGGAGCGCTT
CCTGAAGCTGTACTTCCGGCGCGAGGCCAAGGAGAAGCAGCAGGCCAACGAGATGGAACGTGGAGTTGAGCTGTTCGGCG
AGAGCTACAAGCCGGTGTCGTGCGTCGTGATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62