GenePrediction:GLEAN_1463 Details

Name: GLEAN_1463
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:631763..634624 (+ strand)
Length: 2862
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:631763..632048 (+ strand)
Length: 286
Type: CDS
Source: GLEAN
Position: GCSC_168:632117..632615 (+ strand)
Length: 499
Type: CDS
Source: GLEAN
Position: GCSC_168:632676..633040 (+ strand)
Length: 365
Type: CDS
Source: GLEAN
Position: GCSC_168:634079..634191 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_168:634280..634624 (+ strand)
Length: 345
>GLEAN_1463 class=GenePrediction position=GCSC_168:631763..634624 (+ strand)
ATGGTTTCTATGAAGCTGGCCTATACGGCAACGCTGTTTTCGGTCGCCCTCGGGTCGCGGAACAGTGTCCGAGCAAGCAA
CACAAACAACGGAGGTTCCGACAGCACTTCGCTGTCTGCCAATGCCATCCAGTCGGGTTCTTTTGTGGACGGCTCCACCA
GCATAGGCGCGGCTGAAGTTGGCCAGGCTTTGTCCCAGACATCGCAGAACAACTTTATCAACTTTTGCTCTGGCCAGACC
CTCACGAACGGTCTCCAGATCACCACAGGCTCCTGCAACGGTATCGGTTAGTTGTTACAGAAATAGAACCAACCCTTAAC
AGCGCGTCACAGCGTTCTGACAAGTGATAAACAGTTATGGGTCAGATCCCTGCCAAAACGAATATGATCTCGACCGTCAT
TACCAACCCCCAGCTGAGCCAGTCGATCAAGGCCGGAGTGGAGTTCAACATCACCGTCCAGACCAAGAATCTGGTGGCTG
GTTCGTTCACCAACGCAGACGCCACGTACTACTCAGCACCTCAGCAGCTTCAGAACGGCAATATTGTTGGCCACGTTCAC
GTTACTGTCCAGGATCTTGGCAACAGCCTGAACCCTACGACACCTCCCGACCCGACACAGTTTGCCTTTTTCAAAGGCAT
CAATGATGCCGGCAACGGCAACGGCCTTCTGTCTGCCACTGTTGTTGGTGGCCTGCCGGCCGGAAACTACCGTGTTTGCA
CCCTGACGTCGTCCGCCAACCACCAGCCGGTCATCATGCCCGTTGCCCAGCGTGGCTCGCAAGACGACTGCACCAAATTC
ACCGTCACCGGCAATGGTGGTACTACCAACGTGGCAGCCAATGATGGAACCAAGTAAGTTAACTGCCGCAGTCACGAGAA
GTGATGCTAGAATCTAACCATATTGCAATATAGTGGTATTGCTGCTGCTGCTCTTGCCCAGTCGGCTGTCGACGCCGGCC
CAGGGTTTACTACCAAGGCTGGCGCATCTGCAAGTACAAGTGCTGCCAGCAGCAACAACAACAATAACAACAATAACAAC
AACAACAACAACAACAACAATGCTGCCAAGTCCAGCAGCACTGCAAAAGCCAACACTAAGTCTAGCAGTGCCACGAAGGC
TGCCAACACGAGCAAGGCTACCAACGCTGCCAAATCTAACAATGGAGGAAATGCTGGCGGCTTCGGAAATGCTGGCGGCT
TCGGTGGCGGCGGATTCGGAAATGGCGGCGGCTTCGGTGGAAAGGCCGGTGGCAAGGGCCCTGGCGGCAGGCTTACACGT
TTCTCACGCCGGACATTTGTTGCCTAAGCATATGGTATAATTGTGCTTTTCCTTTTGTCTTAGTGACCCTTGAGTGGTCC
GGTCGCTGTGGGTTGTGAAAGTGGGTTGTTAGAGGGCTCGATATTTTGTACATTTGTAGTACTCCGTACCTTATTCTTTT
TCCTGATGTCTCACGCAATGTAAACACGATTTGGTTGGGGAGCCGATTTACAGATTAATCTGACATCGCCTTTGCAAAAT
TCACCCCCCCCCCCCCCTTTCTAGTATTGGACTCCTTTTCCATGGGCATCTCATTTACGATTCCATCTATTTCCCTTACT
TATACTCCGTATGTACTAGTGTCTGCCACATCTCTAAAAAAAGGGTTTCAGTGGGAGTAAAGCTAAGTCTAAATACTACA
GTCAGAGTAGTATTGTGATCCGCTAGCTGTACAACTACTCGTAGCAATGGGGCTGTGGATATAGTCGTTTTCTGACAGCG
ATATAGGGGTTCACAGCTCGGCCACAATGATGGGCAATGTTCAGCACGATAGTTTTGGCAGTGTATGATCAACAATCCGA
AACAAGAGCAGTTAGAGTTGGGTGGACATTCAACAATATCTGTGGGGTCGAACGCTGTTATAACGGAGACGTCAAATGCC
AGTTCAATGGACCATGTACTCCGCAGGCTTTGTGATATGGCAAAGTTTATTCATAAGCATAGTATTTGTGTGTTTGTGAA
GTATAGTACATCACTGATTCAACCGAACTTTGGTCTCTTTCGGACAAGTCGTGGTGTGCTTATTGGCAGTATGCATACTG
GACAAAGCGAAAGTCTTTCCTGTTGTGAATGCGTGCTTTCATTGGATAATCTACGTAGATCCAGACCCACTTTACATAAT
CCAATGGCGATATTTTCGGGCTGTCGATCCTGTTCAACTGATTTGGATGAAGATGGTGGCCCTCTTGGCGACGACGACGA
CGACGACGACGACTGCTGAACATTACACCCTCGACTAGAAAAAGGCATACGGAAATGGCCACACACGCTGTCGCAGCCGC
CCAGCGGACGTTCCGCGAACTGCACGGCGTCGTGGTGTCTGCGGGCCTGATGCAGAAGACGGTCAAGGTTCGCGTTGGCG
GCCGCCAATGGAATGCGCAAGTGCAAAAGGTGACGCTCCGCTTTGGGGGCAGTCTGACGGGCAGCCCTGACACTTCCGTC
TGCTTCCGACCAGCCGTGCTGACCGTGACGCTTGCAGCACTTTGACAAACCGCAATCGTATCTCGTTCACGATCCCAACG
ACAGCCTCCGCACCGGTGATGTCGTGGCCATCTGCCCTGGCTGGCGCACGTCCAAGAACAAGCGCCACGTGGTCAAGCAC
ATCATCGCACCGGCGCAGGTCCCGGTGGAGGAACGTCCCCCTGTGCCGACTGAGGCCGAGCGCTGGGCAGCAGCACTGGC
CCAGCGAGCCGCCAAGGACGAGCGACGTGCGGTGATCAAAGAGGCCCAGGAGGCAGCCGAGGCGGCCGAGGTGCTCTCGT
GGCGGTTGCACCGGAAGCAGCAGAAGAAGTTGGCCAAGCTGCAGGAACAGCAGGAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62