GenePrediction:GLEAN_1464 Details

Name: GLEAN_1464
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:640997..644082 (+ strand)
Length: 3086
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:640997..641808 (+ strand)
Length: 812
Type: CDS
Source: GLEAN
Position: GCSC_168:641871..642594 (+ strand)
Length: 724
Type: CDS
Source: GLEAN
Position: GCSC_168:642649..644082 (+ strand)
Length: 1434
>GLEAN_1464 class=GenePrediction position=GCSC_168:640997..644082 (+ strand)
ATGACGTCCAACATCTTTTCTCGGTTTGCCCCATCCGGCCGGGGAGATAGGCCGTTCTTCGAAGAGCTGGGGGACGAAGA
GGGCGATGGAAACAGACTAGATGAAGAACAGAGATCCGGGCTTGCCCTGGATGAGGACAACTTGAACCAGCAGTTCCAAG
ACTACGATCTCGAGCATGCAGAAGGACTGGGCATGGGCGACAGCCGGGCCACGATCGCAAGCGCTGCCGGACCAGCGATT
ATGGGGGCTGCAGCTATGCGGTCGCATGGACAGCCGCGGCGGAACGATTCCCGACCACGGTGGGCGGTCCCTGGCGCAGA
AGATGACGGCGATAACGATGACGTGCCAGGCTCGCTGCTCGTGGAAGCACATGGCCCTGGCCAGGCGCCTCTGCCACCGC
TGCTCAAGGCGGCACCTCTTCGATCCAACGTGCCCAAAAAGGGGACCGGCCCGGCAAAGGCAGGTGCTGGGGCTGTTTCC
GGTGCGGCGACGAAGAGAAACCGGGTGTTGTGGGATGCGGCCCAGAACCAGCAGCGTCTGCACAATGACGAGCCTGCCGG
AGCGGATAGATTTGGTGCGAGCGAAGTCCGGGGCGACAGCCAATTGGCGGAGGCCAGCACAGCCGGGCCGGGAAATGCTC
TGCTGTCATACTTTAAGGCAAGTGGCGGCCGACGAGGCGGGATTCCGCACGATATAGCTATGTGGAGATGGGTCAATGTT
ACGAATCTCGACAACTTTATCCGCGACGTCTACGATTACCACCGTGCCTGCGGCTTGCGGTGTATTCTTATGGAACGGCT
CCTCCATCTTGTGTGAGTTGCTTGGGAGGTGACGCACGCATTGGACGGGCTGCTTTTCTGACCATGTTTAACAGGAATGT
TGCCTTCGTGGCCGTCTTCTTGACGTTTCTGACCCAGTGCCTGGACTACTCAAAGATCCGCGGGAGCACAGAGATGGATC
AGATTCTGGTTCCCCAGTGCACAAGGAACATGTCCTGGATTTGGAACATTGGGCTGTGGCTCTTTGCCTTCTACTTTATT
TGGAAGACAATGCAGTTTTTCATCTTTGATATGCGGCGTCTGCTCAATTTGCGAGACTTTTTCGTCTATCTTCTGCAGAT
ACCTGAACACGACATGCAGACGGTCTCGTGGCAGGATGTGGTTGTCAAGATCATGGCGCTCCGAGACCAAAATCCCAAGA
CGGCAATCAACATGACGCGTGTGCAGCGAGAGTGGATCGGAAGCCAGTCCAAGGAGAGGCTGGATGCTCACGATATCGCA
AATCGTCTGATGCGCCGCGAGAACTACCTGATCGCGTTGTTCAACAAGGATATACTCAACCTGGACATTCCGCTGCCGTT
CCTGAGGAACACACAGCTGCTGACCCGCACGCTGGAGTGGACGCTCTGGTTTGCCGTCCTGGACTTTGTCTTTGACGAAC
GCGGACAGGTGAACCAGGAGTTTCTCAAGGCCAGCCGCCGCAGCCAGCTCAGCCTGAAGCTGAAGTCGCGATTTTTCTTC
GCCGGGTTCATGAATCTGCTACTGGCTCCGTTCGTTGCCTGCTATCTTGTCATCATATACTTCCTGACCTATTACAATGT
GTGTATAACTGCCCGTTTTCTGCGTATCTCCGCTCACTGATGTTTTCTTTAGGAATACCAAAAGAACCCATCTGCACTGG
GGGCTCGAGCCTATACGCCGCTGGCGGAGTGGAAATTCCGGGAGTTCAACGAGCTGGACCACCTGTTTGAAGAGCGGCTG
AACATGTCGTATCCGTTTGCGACGCGCTATCTCGAGCAGTTCCCGAAGAAGAAGACGGAGCAGGTGGCCAAAACGGTGGC
ATTTATTGCTGGATCGGTGATGACGGTCTTGGCCATCGCCTCTCTGGTCGATCCGGAGCTATTCCTGGGGTTCGAGATCA
CGCACGACCGGACGGTGCTGTTCTACGTTGGCATATTCGCGACCGTCTGGGCGACGGCTCGTGGGATGATCACGGAGGAG
AACAGTGTTTTTGATCCTGAATATGCGCTGCGCAACGTTATCGAATACACGCATTACGAGCCGGACCACTGGAAGGGCCG
TCTGCACAGCCACAGCGTGAAGATGGAATTCTCAGAGCTGTACCAGAATAAGATTAAGATCTTCCTGGAGGAAATTGTCA
GCATCCTCATCACTCCACTGGTGCTATTTGTGAGCCTGCCGAAGTGCAGCGACCAGATCGTGGACTTTTTCCGAGAGTTT
ACGATCCACGTCGACGGTCTGGGATACGTCTGCTCCTTTGCAGTGTTTGACTTTAACAAGGACGTGAATGGCGGCGGCGG
CGGCGGTGCTGGTGGTGGCAATTCGAAGCGCCCAAAGCAGCCAGATTCTCTGGGTGCCGGCGCCGATGTGCGCGACGACT
ACTACTCCACGAAGCATGGCAAGATGGCAGCTTCGTACTACGGCTTTCTCGACAACTACGTGATCAACCCGAAGACGGGC
ATTCCGGGACACCATCCTCCAGTTGGAAGACACCATCATTCGCAGTTCCATCCGCCTCCGGCCTTTCCCGGCCTGAACTC
GCCGACGCTGGCGGCCGATATGCAGAGCTCCCGCATGCGGATGCGTGCAGGTGGTGGCGGTGGCGGTGGTGGTTCAGGCC
CGTCGCAGTCCTTGCTACGGACACCTCGGTTTGGGCCAACGGTGGGAGGGCCACAGCCGTCGCCGATGGCATCGATTTTG
CTCGACCCGCACAACCAGCCGTCGGCATCGACATTTGCGAGCCGCAGTGTGCATCGGCTGCGAACGCGTGGCGGCTACAC
CGGAGACGGCCGTACGATTCAAGAGCCCGTGATGGAGGGAGACGACGGAGAGGACGACGATGGAAGTGAGCAACAGCAGC
GTCTCCAGCAGCAGGAAGAAGAGCAGAGCGAGACGTTCCAGGGCGGTGCTGGCCTGGAGGAGTCAACATGGCAGACATCG
CCGCCCAAGGGTCCTTCACGGGAGAGCAGTAGCGGCGTGGTGGAGGAGGAAGACGTGGGTGTGCTCGGTCTAATGTATCA
GTTTCAACAGGCACACATGAACCACAAGCCAGGTGGTGGACGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62