GenePrediction:GLEAN_1465 Details

Name: GLEAN_1465
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:645147..649323 (+ strand)
Length: 4177
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:645147..646235 (+ strand)
Length: 1089
Type: CDS
Source: GLEAN
Position: GCSC_168:646319..646784 (+ strand)
Length: 466
Type: CDS
Source: GLEAN
Position: GCSC_168:646835..646962 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_168:647022..648435 (+ strand)
Length: 1414
Type: CDS
Source: GLEAN
Position: GCSC_168:648494..649323 (+ strand)
Length: 830
>GLEAN_1465 class=GenePrediction position=GCSC_168:645147..649323 (+ strand)
ATGGCAAACCACTTTGGCAACGGGTCGGCTCACGGCGGCCTTGGCGACGTCGCCGCTTCGGCTGTGGAAAACGAGCCGCA
GGACGTGGTGCTTCCCAAGATCAGCGGTGCGCTCGAGCTCATCTACAACCCCCACTCGTCCAACCAGACTCGACAGGAGG
CCCAGAAGTATCTCGAGGTCGTCAAGGATACCACCCAAGGTCCCTCGGTCGGCTTCGCCCTGGCCTCCAACCAGTCCAGC
TCGCCGGTGGTTCGTCACTTTGGTCTGTCCATGCTCGAGCACGCCATCAAGCACAAATGGGCCTACTTCTCACCCGAGCA
GACCTCGTGGATCCGCGGCTGGGTCCTAGAGCTGGCCCAGAACGTCTCGCGCAACGACGCCCCGTTCCTGCGCAACAAGA
TCGTCCTGCTGTGGGTCGAGCTGGCCAAGCGCTGCTGGGCCGCCGAGTGGATGGATATGGACGAGCTGCTCCTGCAGCTG
TGGCAGCGGCCGGGCGACAACGTGCACAAAGAGCTCGTGCTCTACGTGCTTGAGACCCTCTCGGAAGAGGTCTTCAATGG
TGACGATGCCGTTGTCGCTCTGCGCGAGAGCGTACTCAGCAAGGCTTGTGTCGACATTTTCACGCCCTCGTCCGTCCTCA
ACGAATGCTTCCCCAATCGCTCGCGTGTGCCGGTCGTCCGGGCTGGCGACGATGGCTGGCTGCTCCGCGTGTCTGATCTG
CTGCGCAGCTGCCTCGAGGCCGACGTGCAGAGCAACGCCGAGGCGCGCAGCTGTGCTGTCCGTGCCCTGGCCGTCTTCAC
CTCGTTGCTGCCCTGGACCATACCCAAGGCCATCATTGCCAGCCAGTGCGTGCCGTGTCTATGCGAGAGCTTGGCTGCGC
CAAACGTCGCCGTCCAGAAGGCTGCGCTCGAAGCCCTGCACGCGCTGTACTCACGCAGCCATTTCGCTGAGGACGAGTTT
GTTGCCATCGTCGTGCCCATGTACGACTCCAAATACGTCGATCTGTACAGCAGGCTTTTTGAGTGGGCCAAGGTGGATGC
CGACGACATCGACGACGACAGGTACCAGTTTAGCAAGAAGTTTTCCGAGGTGAGTCTCCATCTGCCAACGGCCTGTGCCA
TCCTTCGTCCTGCTCTCTGGTCGTTCATCTGATCCGTTTGTCTGCTGCACAGATGCTATCCTGCCTAGGCAATTATCTGG
ACCGTCGCTTTTCCAGCCTGCCGCAGGGCGTCGACGTCCAGAAGTTCGTCGAGCTTCTCCTCCAGGTCGTGCAGAGCGAA
AGCCTCGTCGTCGCCATACCTGTGTTGGTGACGTGGACCCGGCTGCTGAACCACCGCTCGATCGGCCCCCTGATCGCCGA
TACGCCCTTGATTGGCCCCCTCCTGGAGGTGTGCAGCTTGCGGCTGATTCGATACGAGAGCCTACCCGAGGACACACAGG
ACGCCTCCTACGTCTTTCTCCTGGAAGATACCGACACAATCCCGGAGCGCCATGCGTTCCTGGGCAATTACCGCCGGTAC
AGTTCCCAGGTGATCGAGACGATCGTGCAGCTCAAGCTCGTTGACGCTTTCCGACACGTTCTGTCCCAAGGCGAAAACAT
GCTACATCACCTCTATGACGGCGGTCAATCTCTGAATGGTAAATCCGCCGGCATCTATGATTTTCCTGGCCTGGGCTGAT
TCGTCTAGTGGAAAACTACAACAAGAACTCAATGGCTGTCTTGCGGGTCGATGCACAGTTTACTGTGATCGAGTCGGCTT
TGAAGGGCTACACGAGGTGGAGATCTTCCGGCGCGTCCGATGAAGACCAGCCCGAGGTGGGAGAGCTGCTTGATATTGTC
TGTCTCGTGCTTGGACACTAACACTTGTCTTTTAGCGGCGACAGCAACAGGCTACTCTTGAAGACGAGTTCGAGTCGTGG
TGCAACCGTCTGGTCGAGATGACGTTTAAAGACCCGTGCATCCGCAAACGCGTTCTGCAGCTTCTGGTAGCCTTTTCCAT
CACGGCCTTGGACCAGCATCGCAGCTTTATGCTCAAGGTGCTAGAGCATATCTTGGTCACGTGGCCAAATCTGGAGAGCC
TTGAGCACAGAGCGTTCAACGACGCGGTCAAGGATCTGCAATCGGAGAGCATGGTTGAGCTCCAGCGTCTGGCAACAAAG
CAGCCTGATCATCTGCTGAACGTGTACGACCAGCTGGAGACCAAGGTGAAGGAGCTGGTGCGATCGGGCACGCTTGACGA
GAAGCGACAGATCGCCTACCAAAGTTTTCTCTTCCTCATCATCCATCGGGCGCGAGGCATCGACATGGGCGCAAGAATTC
AAAAACTGCAGATCTTTCTGACGCCCGTGCAGGAGCAATGGCAGGCTCCGGATCTGCAACGGGCGCTGTCTTCGTACAGC
GGCTTCTGCGAGCTGGTCGGCCTCGACAAGGCGCAGGAGTACATTGCGCGCAAGCGCATCGACCAGGTTGCGGATTGGGG
CGCGATCGAGCTGGACGCAGAAGGCCTCGCCCTGCAAGCCGACCTTGAGGCGCGCCAGGCCCTGTTGCCGCTACGATCGA
CAAAGACGTTTCTGACTGCGTCGGTGGAGCGGCTGGAGAAGAACTCGGATGCTTTCCAGGCGTCTTGTGTGCTCTGGCAA
GAATCGGTGCCGCTGATCCTCTTGCGGCTGCTCGAGTTCCTCGATTATGCCCATGCGTCCCATAATTTCAGCAGCTGGAC
ACTGCTCCCCGAAGAGATGCGCCCGTTCGTCGGACGGCTGCTCACCGACCGGTTCTGGCAGTCGGGCATATCCGAGGGAA
GCAAGGATGACTTTTATGCCCGCGTCCTCGACCGCAAGGGAACCATGGAGGGCCTTGCCTCTTCGATCCGGTCCACGGTG
CGATATGTCCGGGAGACGGCCTACTCGATCCTCCTCAGCCTGAGCCGGTTCAGTGTCCAGTTCTACAGCTTCAACGGGCT
GTCAGAGCCCTTGTCACGGGCTCTGTTTTCCAACGCTCTTCATCTGCCGCCGCACCAGATCATCGGACTGCTGAATCTCG
TCCGGTTCCTCGTCGACAACTGCCCTGTCGAGTTCCGCGAACCTTTTCTGCCTCCTCTCATCGCGTCTTGCTTCCAGCAG
ACCTCGGCCAAGCTCGTGCAGGAATGGGGCAGGATCGACCAGGTACAGCAGACGCCGTCCGACGCGGACTCACTCACAGA
GGAGATGAAGGCCGAGAGCATTCTCCGGCAGTTTGGCTATTGTGCTGTGATCATGATGGCCGACTTTCTAGACCCGACCA
GGATCAACAGTGAGTCTTGCCGCTCGCGCTGACCGATATTTGCATACTCTGACTAACCACTTTCAAGTTCTGCTTCCAGA
GAGCACGCAGGCGACAACGAAACGGTTTCCAACCCTGCGGCGTTTTTGTCTCATGCAAACAGGCATCGTTGAGCCCCTGC
TGGTATTTTGCAACAACGTGATTCGAATTCACGACGGCCGCTGCTGTAGCATCGTCCTTCGAGTTCTGCGGACTATCATT
GCAGAGTTTGTCGGCGTGGACTCGGCAGAGGCGCTGCCACCGGCGCCACCAGCAGCACCGACGGCGGCGAATGCGGATGA
CGAGCAGCAGGACGGAGCCACTTCGCGGACACCGGACTCGTTTCCGGTGCCAGCGGAGACCTCGACGGCAGTGCGCGAGT
ACCTGTCCTTGGAGGTGCTCAAGAGCTGCATCCTGTCGCTGCATGAGCCATATTTTGTGGACCAGCACCGAGAGCTGGGC
TCACTCATCGCGTCCATCCTCTGCCACTACTGCCCGTTGACGACGACGCCCAGACAGGTGCTGCTGTCGCTGCCAGACAT
CAAGCCAGAAGATGTTGTTTTCACGGTCGAGCAGGTGTGCCGGTCCGGCATGCACAGCCGGCAACAGAGGGCGCTCGTAC
TAGACCTGCTCAAGGATCTGAAGGGCGTCAGTGTGGCCGAGATGGGCAAGCTGAGCAAGACGGCCGGCCTGAAGCGCGAT
GGCGGGCGAGGGACCAAGAAGCCCAGTCAGCGAAGCCAGATGGCGCAGCAGTTCATGACGGCGCCGACGACGACGACAGT
AGGAGAGGAGAACGTCGGCTCGCGCATGATGGAGGGAGGCGGGCGGGGCAGCCCCGACCTCGAGGGTGTTGCAGGACTGT
TTAATCTGGCGGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62