GenePrediction:GLEAN_146 Details

Name: GLEAN_146
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:992646..994420 (+ strand)
Length: 1775
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:992646..992701 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_179:992923..993348 (+ strand)
Length: 426
Type: CDS
Source: GLEAN
Position: GCSC_179:993426..994074 (+ strand)
Length: 649
Type: CDS
Source: GLEAN
Position: GCSC_179:994133..994202 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_179:994389..994420 (+ strand)
Length: 32
>GLEAN_146 class=GenePrediction position=GCSC_179:992646..994420 (+ strand)
ATGGCCACGTCCAAAGCCGCGTCTGGCAGGCCTGTCAGCCTTGCCGGCGCCGAAAGGTGAGATCCGGCCGTATTCTGAGA
CCGCCTCCGGCCAGGCAGGGTCCTCATGCTAAAACACGGTCATCGACAGGTGAAGTGTGATGGCAAGCAGCCGTGCCACA
ACTGCACCTCACGCGGTCAGACATGTGCCTTTCCGGACGTCAAAGACCACGCGTCCGTCAGTCGGTAGTAAGTCGGTCTT
GTGGCCCTGCGTCAGTCTGGATTCTCAATTTTTACAGTTATGCTTTGTCGCTTGAGGCTCGGTGTCAACAAATGGACGCC
ACGTGCCAAAGGTTAGAGGTTATCACGACACAAATCCTGCATGCCGTCGAAGCAATCGACAACTACAAGCTCCCATCGCA
GACAGACAATAATTTCAATAAAAGCTTGACCCAGACAACTCCCCCTATTCGAACCTTTTCAAGAGTCGGCGAGAAAGACT
TAAACAAGGCTGGTATGGACGTCAGTGACAATACCAATCCAAGTCCATACCAGCCAGTCGTCGAAGACGAGCCTCAGGAT
CACCTTGGGGCCCTGGGATATATCGATGTCGATATGTCTGACTCTACCGAGTCTGATGATGATCCAGATGTAGATGTGTC
TGATGGCGAGGGTGCTATAGATCAGGCTACCGCGTTCGTCAAGGACTCCTATGGCCGCTTTCGGTAAGCCCTCGATCTCT
GTTCCGTGTCACCCATTCCTAGCTGCTGTCCGAGAAACTCACAGACCTCGCTTGTGCCAGGTTTGTTGGTGGCTCGGCCA
ACAAAATGCTCATCGACGCGGCCAAGGGTATGTCACCCAGCAGTCGGGCGCAGCCGTCACAGACTCCAGGCTCCAGCGCG
CTGATGGATACGGGCAGCGCCCATGGCGACCAGATTTCGCCGGAAGACGATGATGTTGAGCTTCCACTCTTCGTCCGCGG
CAAGATCTGGCCGGAGCTCCCCTTTCTGCCCAGGCCGGAACAGCTGACTCGGCCTCCACAGTACATCTCGGACCTTCTCG
TCGGCCTCTACTTTGACAAGCTACACTACACCTTTCCGGTCCTTTTCAAGCCGCATTTCATGCGTAGCTACGGAAAGAAG
CTTCGCTGTGGTCCGAACGCATCCTCTCCCTCTCTGGACAAGGACTTTCTCAGGGTATTCTTCGCTGTGTGCGCTTCCGG
ACTCCTGCCTGCCAATCCAGACGGCGGCTTCCCGGGCTTCGAGTATTACGAAAAGTCCCTGTTGCTGCACTACGCATCGC
CAGGACAGGCCTCACTCGAGCGCGTCCAATGCCTCGGCCTCCTTGCCATGTGCACTGCCAGCTGGAACACATTGACGCAG
AGCTGGAGTCTTGCCGGTCTTGCGGTGAGGTCATCTATGGACATCGGTCTTCACGTGAACAGCCAATTTGTATGTTCTAC
CTAATCCATGCATGACTCGTATTACTTTCGCCTGCTAAACCCACCAGACGATGCCACATACGGAGAACTCTGGAGACGCA
CAGCGTGCCAGGACCCTACAGAACCAGATAGAAAGACGTACGTGGTGGAGTGTTTTCTGTCTTGAACGGTATGAGCCTTA
CCCATTCGCACGTTCATGTGTTTTTGTTCGCCGCATTTCTCTAAGGTGTGTCCTTGTGTCAAAAGAACAGTATCGCTTTG
TCTCGGTCGGCCCATGGCTGTCGACGAGAAGGATTGTTGCTGTGAGCTGCCTCTCGACATCAGCAATGAGCATCTCGAGC
GACGATACCATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62