GenePrediction:GLEAN_147 Details

Name: GLEAN_147
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:997333..998950 (+ strand)
Length: 1618
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:997333..998226 (+ strand)
Length: 894
Type: CDS
Source: GLEAN
Position: GCSC_179:998280..998526 (+ strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_179:998592..998950 (+ strand)
Length: 359
>GLEAN_147 class=GenePrediction position=GCSC_179:997333..998950 (+ strand)
ATGGAGACCAAGAAGGAGCTCTGGACTGCCGAAATGCCAATTGTCATGGCCACGGTGAGCGACCAGGGACCGACTGTGAT
GTCGAGCTGGGATGTGGCCGCGGAAAAGGCGTTGGTGCGGAAGATCGACCTGCATATCTTCCCAGTCATGATCGTGCTCT
TTGTGCTCAATTTTATTGACCGCAACAACTTTGCGAACGCTCGGCTTCGCGGCCTCGAGGCGGACCTGCACCTCAGCGAT
GTGCAGTACCAGACTTGTATCTCGATCCTGCTGGTCGGCTACGTTGTCATGCAGGTGCCTTCTAACTTGGTCCTCAACGC
CATCACGCGGCCATCGACGTATCTCTGCGCCTGTGTCGCCGTCTGGGGTGTCATCTCCGCCGCCACCGCCGCCGTTCACA
GCGCCACTGGTGCCATCCTCTGTCGTTTCTTCCTCGGCTGCGTCGAAGCCAGCTTTTTCCCCGGCAGCCTCTACTTCTTA
TCGCGCTGGTACACGCGCCAGGAGATGCAGCTTCGCGTCACTGTCCTCAACGCCGGCAACCTGGCTGCCCAGGCGTTTGG
TGGTCTCATCGCCACCGGCATCCTCACCGACATGGACGGCGACCGCGGCCTGCGTGCCTGGCGCTGGCTCTTCCTCAATA
AGAGGGGCTCCCTGACGGTGGCCCTTGCCGCCATGGCCGTATTCGTCCTGCCCGACTACCCCAATAGCACCCGCTGGCTT
TCGGCCGAGGAGAAGCATATGGCCAGTGGCCGGCTCGCCCTCGATTCCGGCCTCACGCTCGACGGAAATATGGACGACGA
TGTCACCGGCTTCCAGGGCCTTCTGCTCGCCGTCAAGGACCCCAAGGTCTGGCTTCTCGGAATCACGTACCACGCCACCA
TCATGGGCTTGAGTGTTCGTCCCATCCATCCTTCCCACGCATTCCAGCCTAGCTCCTAACCTAGCAGTTCGCCTTCTTCT
TCCCTACTATCACTCAGGCTCTCGGCTACAACACCACTGACACGCTGCTCCTGACAGCGCCGCCGTGGATCTGGGCCATG
CTCGTCTCGCTGCCCAATGCCTGGCACGCTGACCGCTCCGGCGAGCGCTTCCTGCACTACTTCGGACCAGCCCTAGCCTG
CATCGTCGGCTACATTATCTCGGCCACCACCACTACCGTGGCTCCCCGGTATTTTTCCATGTTCTTGATGACCAGTAAGC
ATCTTTCTCTCCGACGTTCATCCCTACACCTGCTATATAAGCTGACCCTGATGTCGCAGCTGGCTTCGCGTCCGGCTTCA
TTATGCTGGCATGGATCTCCAACACCATTCCCTACCCGCGTGCCAAGAAGGCCGCCGCCATCGCCATGGTCAATGCTATG
GGAAACATTGGCTCCATCCCGGGCTCGTATATATGGCCGGCCAAGTACGGGCCGCTGTACGTCAAGTCCTTTGGCGCCAT
GATTGCCATCCTCGGCTTTGGCTGTGTGTGCGCCTTGTTCCTGCGCTTCTACCTCATCGCACAAAATAAGAAGCTCGACC
GTGCTGAAAACATGGCCATGACTGCTTCTGGCGACGACAGGGAAAAAGCAGTCTCCACAGTTGTCCGCATGGACAAGAGC
TTTCGGTACCTGTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62