GenePrediction:GLEAN_1486 Details

Name: GLEAN_1486
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:107517..109352 (+ strand)
Length: 1836
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:107517..108194 (+ strand)
Length: 678
Type: CDS
Source: GLEAN
Position: GCSC_82:108249..108456 (+ strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_82:108554..108949 (+ strand)
Length: 396
Type: CDS
Source: GLEAN
Position: GCSC_82:109039..109153 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_82:109237..109261 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_82:109317..109352 (+ strand)
Length: 36
>GLEAN_1486 class=GenePrediction position=GCSC_82:107517..109352 (+ strand)
ATGGACATCTCAAATATCTACAAAGACGCTTTATGCGGAAAGTTGAACAATGAAAAGCTGAAACATTATTTGGCGTTGGG
GGAAGATATCAACGGTAAGAACACTGGCATTGCACTCACGCCCCTGATGGCTGCCGTGGTGCACAGCCGTCATAAAGTAG
TGAAGCTGCTAGTCGACAACGAGGCCGAGACGCACACGGCCTCGGCTGCAGGGCAGACTGCGCTATGGCTGGCAGCTTCC
AAGACAAACAAGCACCGCAAGGAAATTGTTCAGCTGCTTCTGGATGCCCCACAGTTTCGGACTGAGGACCTGAACAAGAT
CCCCACCAACAGCGGGGATGGAAACACGCCCGTCATGGAGGCCGTCCAGCGTGGGGATGAGGTCATTGTCAGGATGCTGG
TGGATGCAGGGGCCGACTTGACGGTGGCGAACCGCGAGGGAAAGCGGGCCAAGGACCTTGCCGAGGAGAGAAAGGACAAG
AAATTGCTCATCGCTTTGCTGCCGGCCGCGGAGCGCCATAACCATCATCTGCCAATGATTGACCGCATCGCAAAGTTTCT
TAGATGGATTATCTTCTGGGTGAACGTGTCTGGACTTGTTGCTGGCGTGCTCAATGCCATTTTTGGTCTTACTGGGTGCC
AGAACAGCACCAAAGAGGCTGATACACCAGCTCCATCGGTGAGAGTTTCCCGGTCTCAAGTACCACTAGCCATTCCAGAC
TGACAATTTTAGGGTCCTGGAGACTGTAAGACTGTGGAGGAATTCAAAAACTACGCTAATGAAAGTGGCCTAGAGCGCTT
CTTTCCGAGAGACGATCAGTTTTTGCATCGGCTAGTAGACGGTATCGCCGCATTCAAGGACAGCCCCAGCCCACTCAATA
CGCCTGAGCGAATCGATGGTCTCGTCAAACTGGCTCTCTTCCAGCCCATTCTCTTCTGTGGTACGTTTAATGACAGTTTT
TTTTTTTTTTTTTTTTTTCCCACGCACCATCTCATCACGAGGACGTGCTCCTCATCTTCTGACTTTCCTACCCGCAGATG
ACAGCACATCGATGAAGGGACCCACCAGCGCAGCGTCAACAGTGAGCCGCATCGAGGCGCTGCGCGATGTAGTCGAGCGA
ATCACACGCATATGCAATCTTCTCACTCCCGACGACAACGGTACAGTGATCCGGTTCATCAATCAGAAAGTCACATGGGG
TCCTATGAATGCCGACCAGGTCCGCGAAAAGATGCGAGATGTTGTGCCTAGAGGAGGGACTAGAATAGGAACAAACCTTC
TGAGCAAAGTGCTGAAGCCCTTTGTGTATGAGCAAATAGACGCGGGGGAGAAGGCGGGCAGCGGTATCTATCTGAACAGG
CCATACCTGATCTGTATCATCACCGATGGATGTCCAACTGATGGAACCCTGTTTGCGGAGTCCATGCAAACCTGTATTGA
CCGCCTGGAAAAACATGGGCTTGGAGACCGATGTATGCCAAGCAAATTCTGAATTTTCCTCTAATCGCTGACTTCTTTGC
AGTGGTCTCGTTCGTTGTCTGCCAGATTGGCGACGATCCTGGAGCGACAGCCTTCTTGCGGACTCTGATGGAGAAGAAAA
ATGAGTTTGGTGACTCTGTTTATGTCTGCAAAGGCACGTTCTCTTCTCCAATATATTAAACAATATCCTGCTAGCAAAGG
ATTCAGAACAACTGGACGACAAATTCTCTTCACTGAATAGGAATAATGATGATCTAGAAATCCGCGTGAGTCTAACTTAG
CTACCAAGAACATCATTCCCTGACTAACACGCATCAACAGCTTTTCAATATTCTCGCGACGCCACTCATGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62