GenePrediction:GLEAN_1487 Details

Name: GLEAN_1487
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:113033..117288 (+ strand)
Length: 4256
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:113033..113118 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_82:113180..113783 (+ strand)
Length: 604
Type: CDS
Source: GLEAN
Position: GCSC_82:114639..114652 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_82:114750..114876 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_82:115543..117288 (+ strand)
Length: 1746
>GLEAN_1487 class=GenePrediction position=GCSC_82:113033..117288 (+ strand)
ATGAGCAGTATAGGAGGACACCGGCGACACCTTCTGAAAGAAAACAGGAAGGATGTTTTGGTCATTGGCATCGACTTTGG
GACGACGTAGGGACCAATACACAAGCCCCTGTACCATTGGCCGGCATTAACACAAGTTCTGAATTAGGTACAGCGGCGTT
GCCTGGGCCACAGCAGCTGATTTCGAGAAAGGGAGCATCAACGTAATTTCCAGTTGGCCAGGAACCGGCCGCGAAGAGGG
CAAGGCTCCAACTGAAATCTCTTACGATGGCGGTCAAGTTCTGTGGGGCTACGACATTCCAACTCACGCTTCACGAATCC
AATGGTTCAAGCTCCTCCTTCTAGAAAATGAAGATCTCAGCTTGGAAATGCAAAAAACCCCATTCATCCAAAGCGCTCGA
GACAGGTTGCGGAATACCGGGAAAACGGCCGTAGATGCAACGGCCGACTACTTAGGTTTATTATGGCGCCACGTGCTCAG
CGTCCTCGAGAAGGCACTTGGGAGCTCGGTCAAGGCTCTATCGTTCCATGTTGTCCTAACCGTGCCGGCTATCTGGAAAG
ACTACGCCCGACGGAAGATGGAAACTGCTGCCCAACAAGCAGGGATACTGAGTCGTCGCCTTGCCGGACCAACGCGCTTG
AGCCTTGTGCCTGAACCCGAGGCTGCGTCGCTGTCAACGCTTCTCGATCGCCATGACACGGTTGCGGCGGGTAAAGTATT
TGTTGTTTGCGATGCCGGAGGTGGTACAGTGGTAAGCGCTGTACCCTAACGAAGATCTAAGCCGCATTTTAATTTCCACT
TCACTAGGACTTAATCACGTATGCGATCGAATCGTCTGATCCGGTTCGCATGCATGAGGCTGTGGAAGGAGCAGGTGTGT
ATCTGCTTGCATTGATCTCACACGCGATAAACACACTGACATCGAAATTCCCACAAGGTGGTCTCTGCGGTGGTGTATTT
ATCGACGAATCCTTCGAACAGCTTTGCAGGACTCGATTGGGTCATGTATGGCAAAGTGTTACACGAGCAGGTAAAAACGA
AATGCTGAAAGGGGACTGGGAGTTTTCTATAAAACGTCATTTCAGCCCGGGAAACACACAAAAGGAATACATCGTGAGCT
TGCCGACTGAGTTATTTCACGAGAGAGGAACACGCAGTTTTGATGACACTACCAAGGAGCCAGTCATCAAACTTGGCCGC
ATTCATTTCAAAGAGTAAATACATGGACCTCTAAGCCGAACTACGCACTAACTGAATTTATAGAAACAATATAAAAGAAA
CTTTCACGAAAGTGTTTTTAGCCATATCAAAGTTGGTCAATGCCCAAATCCAAAAGGCGGCCGAGCAAGGTCGCCCTGTC
ACGGTATATCTTCACAGTCGGCGCCACCCCCTAGCAGGAGAACCCTTACTAATATTACGGCTTCTAGGGTCTAATTCTTG
TTGGGGGTTTAGGTGGGAACCCTTACCTTTATGATTATATGAAGGAAAATCTCTCCTGGAGGGGCATTGAAGTTCTCCAG
CCCAGTGGAATGAAGGCGTGGGTGCTTTATTATGGCCTGATCCAATGACGATGACAGAGAGATGTTGCTAACGAGCCTTA
TACTAGACGAACCGCAATCTGTATGGGTGCAGTGTGCAAGGGCTTTTTGGATGACGAGGACGGGATCTGGCAAAGTCAGT
CACAAAAACCAATTGATATCACGTCGACAATTTGCAGAATCAACGTCGGGATTGTGATTGAAGAGTTTTTCAACACCACA
AAACACCGCGAAGAGGACAGGATCTGGAACGATACGGAGGGTGTCTGGAAGGCGAAAAATCAGATGAGGTGGTACTTGAA
GAAGGTCTGTGCTCTAATTACACCCCCCCCCCCCCCCCCCCCCCCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAACTTTCTTTAACACCAGCCAGGGGGAATGCGTATCGAAAAACGACCAAATTAAAAACAGCTACTACAACATATTCGA
AACAAGTTGGGATGGACGGTTTAAAATGGATATGTATCAATGCGACGACCTTGTGCCTCCAATTCGTTGGTCAACAAGAG
TTTCTCCGTTGTGCAGTTTCCAGTGCAGCCTTGAGAACAGCATATCAGTGTCAAGTCTCGCAAACCACACGACTCCACAA
GGAAAGCGGATGAAGAGGATAGACTTTGACTTGCGAATGACTCCGAGCGGCAGGAGTGTGGATTTTGACGTTGAGGTCAA
TGGGATTCGCCTCGGACAGACCAATGTAGATAAGAAGTTGCTGACCAGCAGCGCCGCTGATCTTGATTTGTCACTTCGGG
CTTTGCAGATATAGAATCGTGCCTTGTTGGCAGAGGGGAGTTTAGCCGTTAAAACATTATTCTTTTACAATTGATGTCTT
GTTGCAGTATACATACATACATCGTTCGTAGATTTTGGCCACCTTTGGACCCACCGCACGAACCAACCAAAGCCGCGCGG
CACTCATCATCTTATCAGCACCAAACGCAGGGAACGTCAACACCGCCAGCCAAGTATGCCATGATCAATCGACTGTCCGA
ATCGACGACCTACAATCGCCGCGTTGCCGTCATGGCCCTCCGAACGCTTTCCTCTCTCGTCCTGGCGGTGTCGCTGGCAG
CAGCTGTCGACGTCCGGGACAGAAACATGGACCTGGAAAGAAGCACGAATAGCGGCCCCAGTATTGACATTGCCCGCCAG
CGCGGCCCGGCCATCTTCAACGCGGTGCACGACGCTATGCGCCAATGGGGCTCATCGCTGCACCACAACGGCATGTCCTT
CTTCCTAGCCACGGTGCCAGAGGGTGTGCTGCTGCACCACGGCAGCAGCCAAAAGGCCTCACCGACACATCCGGAGTGGC
TGGCCTACGAGATCGAACATGCCGAGAACTTTGCCCGGCCACCTGGCTGGCCACACCGACCGGAGAGAGGCAGGCATGGC
GATGCTCCGGAACGGCCGAAGACGCGAGAGGACCCTCAACAAGTCCTTCGTCCAGAGGCGAACACACAGCCGGAAACGGA
GGCCGGCTGGTTGCACGTGTACCGAACCATCCGACCGCTACACTACCTCTACATCGACGGGATGGGCGCTGGCAAGACCA
CCATGGGCACGCTAGACTCACAGGACTTTGTCCTGAGGGGGCTGTCGCCCGAATCGGTGGGGGCAGAACACGGACGCGAA
GGCCCCCCTGGCGGTGGTCCTGCAGATGAGATGCAGCGCGCCGCTGACCTCTGCCGTCTGGTCACGCCCTGGGGACTGCA
GGGGGTCATCCGGATGGAGGCCGGCTTCGAGATCATTCAGTGTGACTTTGCCGACGGTCTGGACCAGGTGCAGGCGTTGC
GCCGGCCGAGAAGTGTCGGTGGTCCCGGAGGCGGACCCGGTCATGGAGGCCCCGGCGGTATGGGCAGCCTCGAGTTTCTG
CGTGGCCTGTCGGAGCGATACCAGGGTATCGGCTCGCATCGCACACGCATCGACTACGCCTCCATGGTGTCGGCCTACTT
CTTCCCGCTCAACCTGACGAACCCAGATGTCCAAAGGCCGGATCTGGCGCGTCTGGTGTCGGCCAGCACAGACGGATTGG
CTGCTGTCCGGACGCAGCTGGCGGCTGTCGTGGCCAACCGCAGCGACACGGCGGCCGTTCGCCCGATCGACTGGCAGGAC
GTCACCGACATGATCGTGGCGCGCTATGCCGACCGCCTGCAGTATATGGCGACAGAGGTGACGTCGACGGCGCTGCTGGT
GCGCGAGCTCGGCTTCCTGCTGGACGTGTTCATCGACTACGAGGACGATGAGGCAGACACCGACTTTGGCCGGGCCGTTG
ACCGCTGCACCGACTATTACTTCCGTGCCGTGGTCCCGACGACAGCCACCGACGAGCTGATCCAGGCGGCCCTCGTCGCC
GTCACGCACGAGATCTGTACAATGCTGTTTGGCGTGCGAGAAAGGCTGGAAAGCAAAACGGCAGTCGAACGTACGGAGCT
GGACGCGAACGTGGCCTTGGCCGACGCCGTGGCTGAGCTACGCTCGCTGATGACACACCTCAACTGGGCTCGGTTCAAGC
GCTGTCCGACATGTGCCCTCGGCCAGGTGTGCACCATCCCGATGTGGCCAATGGGAACAGTGGGAATGTACAACTCGCCC
CGGTGTTCCAACGGGTCGGACATGTGGAACGAGGAGAGCTACTGGGGGTCGTTCGGGCGACCAGGTGGTCATCGGGATGA
CCCAGAAGGCCGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62