GenePrediction:GLEAN_148 Details

Name: GLEAN_148
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1001798..1002681 (+ strand)
Length: 884
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1001798..1002081 (+ strand)
Length: 284
Type: CDS
Source: GLEAN
Position: GCSC_179:1002138..1002681 (+ strand)
Length: 544
>GLEAN_148 class=GenePrediction position=GCSC_179:1001798..1002681 (+ strand)
ATGCATCTTATTCTAACTGGAGCAACGGGTCTCGTTGGCTCGGGCGTGCTCGATGCTGTGCTAGCCATGCCCGATGTTAC
GCGCATCTCCATTCTCTCGCGTCGTCCGGTGCCCATGGTCGAGACTCGGACAAAGGCTGGAGACCCGGTCATCACGCCTG
ATCGAGTGCGCGTCATTCTTCACCAAGACTTTTCTGTCTACGATGATAGTCTGCTGGAGCAGCTAAGTGGCGCTGCCGGA
GTTGTGTGGGCGCTGGGCATCAGCCAGACTCAGGTAGACAAGGAGTAAGTATTGTTGATGGTCCTCACTTCGTCCGTTCA
TGGCTCACGAATACACGCAGTGAATACTACAAGATCACCCACGACTATCCCCTGGCGGCAGCTCGTGCCTTCAAAAAGCT
TCCACCACCTGAGGGCGTCGCTACCTCGCCCGCTTCGTCCTTCCGCTTCGTCTACGTCTCTGGCGAGGGCGCAACCACTT
CACCCGGAATCACGACCACTCGCTTTGGTCGCGTCAAGGGTGAGACCGAGCTGGCTCTGGCCGCCCTCGCTGCCGAACCC
AAGTCTGACTCCGAGTCGCCCCTTGCCGCCATCTCCGTCCGTCCAGCAGGCGTAGACCCCACCCACCATGACGCCATACT
TCCTTACATTCCGCCTGTATCTCTGAGCCTCAATCTTATGCGTAATGTCCTTCTACCGCCACTGCGCTTCGCATATCCCC
CCATGATCAGCCCTACGCGTCCGTTGGGCCAATTCCTTGCCGACATCGCCCTCGGCCGCTTCGACGGCCGCCTCACTGGA
CATGGCATCGAGCTTGTCGGCGGCCAGTCGCCAATCCTTAGCAACGTCGCCTTCCGTCGACTTGCAGGGCTGGACAAGAA
ATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62