GenePrediction:GLEAN_1490 Details

Name: GLEAN_1490
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:138659..139859 (+ strand)
Length: 1201
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:138659..139115 (+ strand)
Length: 457
Type: CDS
Source: GLEAN
Position: GCSC_82:139163..139270 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_82:139334..139452 (+ strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_82:139502..139694 (+ strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_82:139786..139859 (+ strand)
Length: 74
>GLEAN_1490 class=GenePrediction position=GCSC_82:138659..139859 (+ strand)
ATGCACCAGTCCAAGTTCAGTCCGCTCTACAACATCTCCGGCATGGACGCCAAGTACCAGACCGTCAGTCTGCACGACGG
CGCCGCCTCCTCCAACAATGTCCGCCGGCCGTCTGCACGTGACGTCGAGGACCTGGACGATCGCCACAGCAATAGCGGCA
GCAGCCGGAGCAGCCACACCGAGGTCGCCGAGTCGCTGCTGGGCGAGAAGTGGCAGAAGAGCCGGGATCACGGCTCCAGC
GACGAGGACGAGGATGACGTCGAGGCACTCGCACAAAACGCCCGTCTGTGCCGCCGGTCCCAGTCTGCGCTCTTCTCATG
GCTCCGCTGGGGCCTCGACACCGTTCTGCTACTGGCCATCCTCGGCCTCGTCGTGTGCCAGCAGCGCCAGCAGCAGTCGT
CCACGGCCCCTGGCCGGTGGGACTTTGGTGGTGACTTCACCGGCGTCGGCCCTCGCAGTACGTTCATTTTGCTTTCCTTC
CCGTGCCGCTCTGACCAGTTCCAGTCGACCAGCAGATCCTCCGCTTCCAGTCGGACCAGTCCTACGCCCCGATGAACTCG
TCCGAGTTCTTCACCGATACCGTCCTGCAGAAGTGGAATAAGCTGATGCCAAGTATGTCTAATGTCTTCTTCCTCTGCCC
CGTCCTCCTCCTCCGCTCGGTACTGACACGCGTAGTTGGCATGGGCTTCGTCTGGGTCAACGACACCCACCGCTACCACG
ACCTGCCCACTCCCATCGACTGGCCGGAGAAGACCGTCTTCACCACGTCTGTCACCCACCAGCTTCACTGCATGGTAGGT
CCTCTCTCTCCCTCTGTCTCGGTCACCGCTGACACCCCGCCAGTTCACCATCGCCCAGACGTACTCTGGCCTCAAGTCCG
GCCACCCCATTCCAGACGATCACCATTGGCACATGGTCCATTGCATGGACTACATGCGCGAGGCCGTCATGTGCAACGCC
GACATTGCCCTCGAGGGCCATGAAACTACCTTCCCCGACGACAATGGTGGCTCCGACGGTTGGGATTCCAAGCATGGTAA
GTCTTTTTATTTTATTTCTTAATGTCGTTAAGTTCTTTGTTTCCTTATTATTATTTTTATCTGTTACACCAATTCTAACA
AAACAAGTCTGCAAGGACTACAGCCAGGTCAAGGCGTATCTGGAGAGCGTCCGCGCCTACGATGATCAGCTCATCTACTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62