GenePrediction:GLEAN_1491 Details

Name: GLEAN_1491
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:142657..144124 (+ strand)
Length: 1468
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:142657..142695 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_82:142757..144124 (+ strand)
Length: 1368
>GLEAN_1491 class=GenePrediction position=GCSC_82:142657..144124 (+ strand)
ATGGCGCTGAACAGGAAATACTCTGCTCTGCCTGATCTGGTACGTGTCTTTGTGTGATGCACCGGGAAGGGAAGTGGACA
TCCTGCTGACATACTTCCAGGACACCGCCCCAGACGTTTACGAAACCCCAGAACTGACAGACGACAACTCCACCGTTCTC
ACCACAGCAGGACGGTCACAGTCGGACGATGAGTCGGACGTGGATGACGCCGATGCGGGAATTTCGCGGTCGCATGTTCA
GGTCGGCCAAGCTCGGTCTCGGTTTCTAGGGGCGGACGTCGACGCACGTGGCGTGGATTTCTCGGATCGCGTGGATGGCA
AGCGAAAGGCATACCGAACGGCGAATCGGCGGCACCGTGGTGCGCAAGAGCTGGGCGACCTGAGCGACGAAGAGGACGGC
GACAGTCTTGAGCGCAAGATTGCCCGCCTGAAGCGGGAGGTGGAGGAGACCAAAGAGGCCTATGCCAGACAGAAGGCAGA
GGAAGCCAAGGCCGAGAAGGCAGCAGCGACGGCAGAGCTGGCTGCTGCTCCTGATCTGGACTCGCTCAGCCAGACGCTGG
ACGAGCTTGCCCGGCTGTCGGACAGGGACGTCACCGCCGCCCGCATCGCCCCGCCTGTGCCGCCGTCATCGACGACGGAT
CCTGCTGCTAATGCTGATGCTGTTGCGAGCGAAGACGCTGCAGCACAAGCGAGCAGCTCGGCCCCGATTGCGAGGCTGAC
GACAGCCGTGCCGTACCCGAGCAGCCTGGCCCAGGTAGCCGATTTCGACAGCCGGCTGGTGCTGCTCGAGCGCTCTATCG
GCATCGGCTCGTCGGTGCTGCCAGAGCTGGACGGCATCGGCATTGGCGGCGGTCCCGGCGGCGGCATCGGTGGTGCGCTG
CCGCGTGCCATCCTGCCGACGCTGGACGCGCTGCAGCGGCAGATTGGCACGCTGGCCGACGCCTCGACGGCCTCGCTGGA
CGGCATCAGCCGGCGCGTCCGCGCGCTCACCCAGGAGGCCGACGAGCTGACCAAGGCGCGCAAGGCGGCCAAGGCGGCGC
ATGAGGCGCTGGTGCAGGCGGGCGCCAGTGCTGATGTTTCTAGTACTGCTGGTGCTGGTGCTGGTGCTGGTGCTGGTGGT
GCTGGTACTCCTGCCACTGCCGACATGGCAGACGAGCAGTCGGCCAAGATCAACGCGCTCTACGGCACGCTGCCGACGAT
CGAGAGCCTCACGCCGCTGCTGCCACCGCTGCTGGATCGTCTGCGGTCGCTGCGGGCGATCCATGCCGACGCGGCCGCCG
CAGGCGAGCTGCTCGACGACTTGGAGCAGCGCCAGGCCGACACCGCGGCCGAGGTCCGGCTCTGGCGCGAGGGCCTCGAG
AAGATCGAGGTCGCCATGCGCGAGGGCGACACCACCATGAACAAGAACATGCAGGTCATGGACGGCTGGGTCAAGGGCCT
GGAGGAACGACTCGATAAGGTCCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62