GenePrediction:GLEAN_1492 Details

Name: GLEAN_1492
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:144779..146760 (+ strand)
Length: 1982
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:144779..145400 (+ strand)
Length: 622
Type: CDS
Source: GLEAN
Position: GCSC_82:145496..146760 (+ strand)
Length: 1265
>GLEAN_1492 class=GenePrediction position=GCSC_82:144779..146760 (+ strand)
ATGGCCGGGCCTCAAAGGAAGCCACGCCTGATGTCTCTCTCGGCATCGGCCAGTCTCTTTGTATCGTCTACTACCGCGGC
GAAGAAGAGGAGGACACGAGAGCCCGTGGCGGTCGATGCTCTTCCTCTGAGCAGCAGCAGCAGCAGTGATGAGCAGGCGG
AGGGCGATGGTGGGCAACGGAAGGGGCAGGCGCCAAAGATTGGCCACGCATCAGACTCATCGGCAAGCGCCGGCTACTCC
AGACGGGGTGACATGGGACAGACAGAGTTTCGTCCGTCGGCGGCGCCGGTGCGAAACGCACGACAGTCGAGCCAAACGGG
GACGGGCCACAGGGCCATGGATCTCCGGCAGCGGTCGATGGGGAAACGAGGAACCAGCACACAAGACGACGACGACAGCA
GCATCAGCTCACGGGGATCAAAGCGGCCAAGGCCGGCTGGGGCGGCGACGGTGACGAGGGCCTTCCAGCCGCCGTCCTCC
CAGGCCAGCAGCCAAGGCTCCCAAGCCAGCGGTGCTGATCCTTTGTTTAGCCGCACTCGCCAACACCCGCCGCAGGTTGG
GTACAGCCGGCAGCCCTCTTTCACATCTGCAGGTCGCGGTGCCACCAGCTCTTTCAAGAAAGGTACAGTCTTCTTGATCT
ATTGGCCCATGTCGTCTGTTTTGTCACATGTCGGTCAGCAGTTACTGATTACGGGCGCCGTTTTTTTTTCCGTACAGTAC
ATGTCCACGGAAGCTCTGACGTTGACGAGATCAGCGAGCCGGAAAGCCGATCCACCTTTATCCGACCGTGCAAGCTCTCG
CCCGAGACAGCATCGCTTCCCAAGAGGTTCCAGCTTAAGAAGCCTGCAGCTTCCGAGGACGAGGACGATGCCGCGACAGT
GTCAAAAGCGCAGTTCAAGTGGCCAGTCAAATCCCTAGCGAGATCGCCACCTCCGACGAAGAAGGTAACAGGAAAGAAAC
ACGCGGACATTCCGCTCGGATCAACACTAGAATCGCTCAAGAGCAGACAGAAGTGGAGGCAGCGACAGCGACCAACGCAG
ACAAAGGAGAGGCCGCGGCCATCACGGCTAGAGGAAGCCAAGAAAGCCCTACGAAAGAAGGATCCCGCTGCGTCCAGTGA
CAGCGCTGACGACGACGAGAACTCCGCACGGCCGGCCGTCTTCCGGATGCCGGCGGTATGCAGCACAGACGAGCATGCAA
GCTACAACGGTGGCGAGCCGATCTCCTCAGACGAGCATGCCAGCGACAGCGGCGACGACAGCGAAGAGACGATGGCGTTT
GAATCGGCAGTGTGTCCGCTCTGCAGCGCACCCATGGACGAGGAGACGCTGCTGGCGCTGCTTCCACCGGACAAGGGACC
CGGCAAGGTGACGACGTCAGCCGGCAGTGTGCGGCTGCAGCTGATGAAGTTTGACGAGAAGATGAGCTTCTGTGCGGCGC
ATCGGCAGCGGACAGCCAAGAAGACGTGGACCTTGCGCGGCTACCCAGACATTGACTGGGACCGGCTGGAAGGGCGGATT
CGGAAGCACGGCGGACACGTGCAGGGCGTGCTGGAGGATAGGGTGCCGTCACACTTCCGGAGGCTGCTGCAGGAACAGCG
CTTGGGTGGTGGCAGCATCGGAGGCGACGCTAGGGATCCCAGCCGAGGTAGCACCACCAGCGTGCCAGGCTACTACGGAC
AGCGAGGTCTGCGAATCATGTCAGAGGCGATTGTGCAGCGGTTCTCGGTCGTGCTGAGACGGCAGGCAGTGCAGGACCCG
CTAATCGCGGCCCGCGGCTACCTGCAGTTTGTGCAAGACGTGTTGGTGCCGGAGCTGGCGGTGCGGCTGATCATGGAGGA
CATGGGGGTGGGGGCTGAGGGAGCACGGCAGATCCTAGGCGAGAGCGTAGCGATGGGCGAGCTGATGCACGAGGACGTAG
ACGTGGTGACAGATGGCGAGGACGAGGACGAGGCACTGGAAAGTGGGAGCGACGGAGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62