GenePrediction:GLEAN_1493 Details

Name: GLEAN_1493
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:149260..156487 (+ strand)
Length: 7228
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:149260..149480 (+ strand)
Length: 221
Type: CDS
Source: GLEAN
Position: GCSC_82:149543..150335 (+ strand)
Length: 793
Type: CDS
Source: GLEAN
Position: GCSC_82:150416..155807 (+ strand)
Length: 5392
Type: CDS
Source: GLEAN
Position: GCSC_82:155922..156169 (+ strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_82:156248..156487 (+ strand)
Length: 240
>GLEAN_1493 class=GenePrediction position=GCSC_82:149260..156487 (+ strand)
ATGCCCAGACATGAACCGGTCTCGCACGTCAGCTCACTCACGAGCTCTTCCACCGACAGCGGCAGGTCTGCCACAACGGT
GAAGCCGTTGCCCTCCAAGCCCTCATATTCGACCGGGCCCGTGTCCCCGGATTTCCGCGCTATCATGCACTCGCCCTCGA
TCAGCTCCCGCCGTGGCCCGCCGTCGCGTTTGCAGATGGACGAGAACGGGAATTTACGACGGTAAGATGCGTCTCGGTGG
CAGGGAAGCGACCCTCACCAGCTAACCCTCCCCACAGAAACAGAATGTCTTCTGGCAAGGAAGATTTGCAGGTGTCGCCC
ACGATTGCCGCCCAGCGCGGCTCCATCATGTCACCGACGCCCATCTCCGTGAAAGCGGCCCATCGCGAAAACCGGGTCGA
CTTTGGCAATTACCGCCACGATCTTGCCGCGATCGACTTCAGCAGTGGTGGTGGCATCTCCGACGGCACAGCTAGCACAG
CCGGGAGCAGCAGCCGGGGAGGAGCCCCTCAGATCCCACACATTCCGTCCATCAGCAACACCGGCCTGCACCAGGTGGCG
CCCTGGATGGCAGGAATCAGCAGTGCTGGTGGCAGCGTCTCGGCACCCTCCATCACCAACACACCACACTCGACCTATTA
CGACGACTCGAGCGAGAATGTCTCCGTCGCGTCGCCGCTATCACCACCTCTGCGCTCGGGCAGCTCCCGGCAGGTGCAGA
ACCCGACCGGCAGCGAATCGCCCGAGGCGCTCTACTATGGCGACGAGCGCAGACCTTCTATCGCCAGCGTCGCCACCGCT
AGCAGCCAGGGCTCTAGGGCTAGCGATCGTCGTGGCGGCGGTTTTCGCAAGCTGCAGGGCTTCTTCGGCGAGGAGTACCC
TGGCCGCGACTCGTCAGAGACGAGCCTGAACACCAAGGAGCAGCGCTCTCACAGCCACAGCCACGGCCGCCCGCATCGAG
ATCGCAACTACTCCAACGCGACGGATCATACCAGGGACGCCTCGCCTGCTTCTTCTCGCCCACGCACCCCTGTCCCGGCG
CCAGAAGTCGTTCCCTTTCTCTACCAAGAAGCCAATGTACGTAGCTGTCTCTTAGGACGCCTTCTTTCTCGTCCTGTCCC
AGTACCCTTTGCTGATCACCACTTTCTTTGGTCTAGGACATTGTCAAATACGGCGAGGCGCCAGTGCGAAACATCCTCAG
CGGCCCCGACCGAGACCGCTATGTGACCGATGCGTTATCCCAGATACCTCCGAAGACTTCATCTTCCTCCCGGTCCGCCC
ACTCCATCGCCCACATGCCCCACCACCGCCACAACAAGAGCAATGACGATCCTCGGTCGCTGCGGCCAACGATCAGCAGA
GAAGATTCTTTAGCCAACATGCGAGAACGGGCAAATCCCTCCTTCTCTTCCGCTAGGCCTCGCGCCCAGAGCCCCACTCC
GAGCGGTCATAGCGGCAGCACGATCTTTGGGCCTTCAAAGAGCAGCAGTATCGCTGAAGGGCAGATTTCCCCTAGCGGCC
ACCAGCCCAAGAGAGGCATTCTCGGCCGACTACGAAGACACAAAGACAAGGATGAAGGGCTTGGCATGGCCGGCCTGTCC
ACACCGGCGAAGCTCGTCTCGTATTCGACTCAGAGCCTATTGTCCCGTCCGTTGCGACAGGAGCTTCCTCGACTGGACGG
CGGACCGCTCCTTTTTGGCTCGGACCTTCCGCAGCGCTACTACGGCAACGCTGAATCGGCTGCCTCTATCCGTTCGGGCA
TCAGCTCGAAGCAGGCGACCTTCAACAACAAATTTCCCTTTTCTAAGAAGCCGCGGACACCGCGCCATACAGATGACCAG
GAGGAAATGATCGGACCCACAGACCGAGCTGACGGCGGCACGCGTTTTTACTTGGACACCGATCTAAACAACATGGACGG
CAATTTGGGCCGTCCCCTGCCCCTCACGCCCATGGATGTCGACTTCCTGCGCGGAGTGGAAGCCGACAAGGCCAACAAGA
ACACGGCACGGGTCAATCATTACTACAACAAGAATGCGGCGAGCGCACGAGCTGCCCCCGTAAACAGCACGGTGAACGGC
ACCCGGAGCAGCTCAGAGAAGAGCTCCAACGGACCGGGCAACCCTGCAGGAGAGGCGACCGGTCCAAACGGCGCGTGGAA
TGCGCCGGACAGCTGGGCCGTTCGTCGGACTGACGAATTGCACCAAGGACCGGAAACCGACGACTATGGCAGCCCGCCCC
GTCCGGAAGAAGATGCGGTCATTTACTGCATCCGCGTTTTCAAGAGCGACGGAACCTTCGCCACCCTGCCGATGTCCTTG
AACGCGTCCGTCCAAGACATGATCAGCGTCATGGCCAAGCGTGTCTTTACGGAAAGCCAAAACTACCAGATCGTGCTGAA
ACGTCATGACCTTATTCGCATCCTCGGCTCTGGCGACCGTCCTCTGATCATCCAGAAGCGGCTACTCCAGCAGGTCGGCT
ACGAAGAGAGCGACCATCTGGGCGACCTCGGCCGCGAGGACAACAGCTACCTGTGCCGCTTCCTCTTCCTGACCGCCCAC
GACAGCGATTTTCAGACCAAGGTGGACATCGGACTGGGGCGCATGCCCAAGCTCAACCACGTGGACCTCTCCGGCCGTAA
CCTGATCACGATCCCCATCAGTCTCTACAAGAAGGCAAGTGACATCATGTCCCTGAATCTGTCACGAAATCTCTCGCTCG
ACGTGCCCCGGGACTTCATACAGTCCTGCGTCAATCTTCGCGACATCAAGTACAGCAACAACGAGGTGCGGAAGCTGCCT
CCCAGTCTTGGCCGCGCTAGCCGCCTGACCTTCCTCGACGTCTCCAACAACCGGGTCGAGAACCTTAATAACGCCGGGCT
CGAGGAGATTGTAGGAATCTTGAAGCTGAATATGGCCAACAACCGGCTGAAGCAGCTACCGTCCTACTTTGGTGCCTATC
GCTCCCTGCGCCAGCTCAACATCTCGTCCAACTTCCTCGACAAGTTTCCCGGCTTCCTCTGTGACATGGAGAGCTTGATT
GACCTGGATCTGAGTTTCAACCTCATCGACTCCCTTCCCGACGAGATTGGCAAGCTGAGAAATCTGGAAAAGTTTGTCAT
CACCAACAATCGTCTGAGTGGCAGCCTGCCTGTGGGCTTCCGACAATTGGAAAGCCTGCGCGAGCTTGATGTCAAGTACA
ATGCCATCACCAGCATTGACGTGATCTCCGACCTGCCTAAGCTCGAAATTCTCACAGCCGACCACAACAACATTTCACAA
TTCGTCGGCAGCTTCGAGCGGCTCCGGACGCTCAAGCTCAATGCCAATCCCATCACCAGATTCGAGATCAAAAGCCCGTT
GCCTACCCTCAAGTTGCTCAATCTGTCTAATGCGCAGCTTGCCAGTATCGCTGATTCTTTCAACAACATTCGCAACCTGG
AGCGGCTGCATTTGGACAAGAACTACTTCGTGTCGCTGCCCAACCAGATCGGCAACCTGGGTCGGTTGGAAACGTTTAGC
ATTGCCAACAATTCAGTCGGCGAGCTGCCGCCGGAGATTGGATGCCTTATGGAGCTGCGCGTGTTGGACGTGCGCGGAAA
CAACATCCGCAAGCTGCCCATGGAGCTGTGGTGGGCAAACAAGCTGGAAACACTGAACGCGTCATCCAACGTGCTCGACA
ACTTCCCCAAACCAGCATCACGGCCACCCCAGGTACCGGGCGAGCCGGTTACGAAGGACTCGATGTCGAGCGGTGCAAGC
AGACTGAACAGCACCGTCGGCACGCTCTCCTCGAAGCCAAGCTCGGAGGAGCTCAGCGTCGACGACTCTCGGCGGCCCAG
CCAAGCGTCAAGCACGCTGCTGAGCGTCGGCCCCTCGCCGGTGCCGTCCGGCCCCGATCGCAAGAGTTCGGTCGTCTCGG
TTTACGGCAAAGGAGGCCGGAAGACATCGGTCGTCTCGCGGAGCACTGCGCAGACGGGCGGTAGCTCAACACCAACGGCA
ATCTCGCGAAAGGACTCGGGCTTGTCGTCGCGCATCACCAACACGTTTGCCGGCTCGCTGCGAAACCTTTACTTGGCCGA
CAACCAGCTGGATGACGATGTGTTTGAGCAGCTGGCGCTACTGGGCGAGCTTCGGGTGCTGAACGCCTCATACAACGAAA
TCACCGACATGCCGCAGCGGTCTATGACCAAGTGGCCCCAGCTGGTGGAGTTGTACCTCTCTGGAAACGAGCTCACCACG
CTACCCGCGGACGACCTGGGCGAGTACAGCATGCTGCAGGTGTTGCATATCAACAACAACAAGTTCACCAACCTACCTGC
AGATATCTCGCGGGCGAAGAAGCTGGCGGTGCTTGACTGCGGCAACAACTCGCTCAAGTACAACATCTCCAACGTGCCGT
ACGACTGGAACTGGAACCTCAACCCGAACCTTCGATACCTAAATCTGTCCGGCAACCGGCGCCTGGACATCAAGCAGACG
ACGTTCGGGTCGACGGCACGACCGACAGAGAGCTACACCGACTTCAACCGGCTGCTGACGCTGCGTGTGCTGGGCCTGAT
GGACGTGACGCTGACGCAGCCGAGCGTCCCCGACCAGAGCGAAGACCGCCGTGTGCGCACATCGGGCTCCATGGCCGGCT
TCTTGCCCTACGGCATGGCCGACACGCTCGGCAAAAACGAGCATCTATCCACGATTGACCTCATCACGCCACAGTTCAGC
TCAAACGACGGTACTAAGCAGGACACGCTACTCTGCCTGTTCGACGGACAGGCGCTGTCTTCGGGAGGGTCCAAGATCGC
CAAGTACCTGCACGAGAACTTCGGCCGGGTCTTCTTGTCGGAACTGAAGGTGCTGAAGCCGGCGCAGCACGAGACGGTGG
AGGATGCGTTGCGGCGGGCGTTCCTGACACTTAACAAGGACCTGGTGACGAGCTCGATCCAGGCAGACGACAGGATGCCG
CTGGCATCAACCAAGGTGCACCGGGGCTCGGTCGCGTCAATGGTCATGACCAAAGAGGACCTCAACTCGGGCGGCGTAGC
AACGGTAGTGTACCTGCAGGGCCAGGAGCTATACGTGGCCAACGTCGGCGACGCGCAGGCGATGCTCATCCAGAGCGACA
GCTCGCACAAGATCCTGACGCGTAAGCACGACCCAGCAGAGCCGAGCGAGCGGTCGCGGATTCGTGACGCAGGCGGCTGG
GTGTCCCACAACGGACGGCTGAACGACATGCTGGAAGTGTCGCGAGCGTTTGGGTATGCAGACCTGATGCCGGCGGTCAT
GGCGGCGCCCCACGTGACACACTGGACGGTACGCGAGCAGGACGAGACGGTGGTGATCGCGACAAGGGAGCTGTGGGAGT
ACCTGACGCCGGGCCTGGTGGTAGACATTGCACGACAGGAGCGTGGCGACCTGATGCGGGCGGCGCAGAAGCTACGGGAC
CTGGCGATGGCTTACGGAGCCAGCGGCAAGATCATGGTGATGATGTTGAGCATTGCAGATCTGAAGCGCAAGGCCGAGCG
GTCGCGGCTGCACCGGGGCCAGAGCATGTCACTGTATCCGCTGAGCTTGCAGGAGGAGACGTCTCAGTTCCTGCCAACGC
GGCGTGGCAAGCGGACAAAAGGCGAGGTGTTGGACTCGACGCTGCAGCGGCTGGAGGCAGAAGTGCCAGCGCCTACGGGT
CTGATCTCGATCGTGTTCACGGATATCAAAAGCTCGACGAACCTGTGGGAGACGTACCCGGCGGCGATGCGGTCGGCCAT
CAAGCTGCACAACGAGGTGATGCGTCGGCAGCTGCGGCTCATTGGTGGTTTCGAGGTCAAGACGGAAGGCGACGCGTTCA
TGGTGTCGTTCCCGACGGCGACGTCGGCACTGCTGTGGGCTTTTGTTGTGCAGCTGCAGCTGCTCGAGGTGCAGTGGCCG
ACAGAGATGCTCAACTCCACTTCCTGCCAGGAAATCATGGACAAAGACAACAACGTCGTCTTCCGGGGGCTGTCGGTGCG
CATGGGCATTCACTGGGGCGAGCCGCTCTGCGAACCGGACCCGATCACGCGGCGAATGGACTACTACGGGCCGATGGTGA
ACAAGGCATCGCGTATCTCTAGTGTGGCCGACGGTGGCCAGATCACGGTGTCATCCGATTTTGTCTCGGAGATCCAGCGC
TGTCTGGAGACGTACCAGGAGTCGCCGACCGGCAGCATCGGCAGCAGCGAGGATCCGGCCGTAGGCAGCGCAACCGGCGC
CGGGATCGGTGGCAGCGGCACTGGCAGCACAGCAGGGGCGTCGTCGGCGATGATGGGCTTTGACGACGACGTGTTTGCCC
AGGCAATTCGCAAGGAGCTGCGGGCGCTCTCATCACAGGGATTTGAAGTCAAGGAGATGGGCGAGATCAAGCTCAAGGGC
CTCGAGAATCCGGAGGTGGTGTACTCGCTGTACCCACACGCTTTGGCCGGTCGCATGGATGCGCACCAACACCACGAAAG
GCTGGCGGCTGCAGTGGCGGCTGCATCGCAGGAGGCCGAAGGCCAGGCGGCCGCAGGGCCCGTCATGGGTAGCGACACAG
CCACGGCTTCAGCAGTTGCGGCAGCAACTGCGGCTGCTGCTGGCGCTGCTGGCGCTGCTGGCGATAGCACCGGTGGCAAG
ACAGCAGTCACGTCGGCAACAGCGGTCCCCAAGACGATCAACCTGGGCGATCCAGACGAAGAGGTGCTGAGGTCGATTCC
CGAGGCAGTCTGGGGTCTGTGGCGGGTGAGCCTGCGGTTGGAGATGCTATGCAGCTCGCTGGAGGAGGCCGGCGGCTGTG
GGCTGCAGCCGCCAGGAACAGAGCTGTTGGAGCAGATGAAACAGCGTGGCGCGAACGTGACGGAGGAGTTCATGATCAGT
TTCTTCTCTCATCAAGTGAGCCGGATTGAGGTAAGTGTTTGAAAGCAGGCGAATCGGAGAAAGATGCAAAATGCAAAAAC
GGGCAAGAAAGTAAGCTAACTAGTGCAGACGTGCGTCACAACTCTGACGCTGCGACACATGGCCATAGGCGGTGGTCCGA
TCGGCCGGCTAGACGACCTCCGGGGGCCCATGGCAGACGTCTTCGCTTCTTTCCAGCACCAGCTCGCCGAGCTCCAGCAA
TACCGCACGCGGTACGGAAGCATCGAACTGGTTGACAACGCTGGCGATGCGGACGATGCCCACGATGCTCACGACGATGA
CGAAGGCAGTGATACGGAGCAAGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62