GenePrediction:GLEAN_1515 Details

Name: GLEAN_1515
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:350204..352115 (+ strand)
Length: 1912
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:350204..351178 (+ strand)
Length: 975
Type: CDS
Source: GLEAN
Position: GCSC_82:351213..351349 (+ strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_82:351402..351703 (+ strand)
Length: 302
Type: CDS
Source: GLEAN
Position: GCSC_82:351758..351859 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_82:351928..352115 (+ strand)
Length: 188
>GLEAN_1515 class=GenePrediction position=GCSC_82:350204..352115 (+ strand)
ATGGATACCCTCTCCTCAGCAACACCAAGGAATTCCGTCTTTGACGGACTTCTGGCGCAATGCTTGCTATCTCTTTTGTT
CGGCACACTCTCCCATATCCTATACTACCGCCACGGCTTCCGCAACAAGCAATCCCTGGGTATCCTTGTGTATCATTTAG
TCCTGGAAGTCGCACTTGCCACCAAGCTGTGGCTCAGCCATGGCTTTGGAAGAGGGTCCACGATGGCTTGTGCCATTAGT
ACCGCCTACGCAACCGGTCTGTTTACCAGTATCCTTATTTATCGCCTTCTCTTACATCCGCTTCGCTCCTTTCCGGGTCC
CTTTGCCGCCAAGGTCAGTCGCCTATATTGGCTTTACCTTCAGCGCAACGGCCATATTCATACCGAGATGCGCTCGATTG
CGGACCAATACGGCGACATTGTGCGCATCGCACCCAATGAGCTTCTGCTCACCTCCCTTGACGCCATCACACAGGTCTAT
GGGCTAAGCACGAGCTGCACTAAGAAAAATACTGGATTATACGACTCCTTTGAGTTCCGTGGCGAGCACAATCTGGACTC
GATCCCCCAGCGCGAGCAACATCGAAAGCGCCGAGCTGTGTGGGACCACGCCATGTCACCAAAAATGCTGAAGGTGTACG
AGGTTGGTATGCGCGAGGTCCTCGAGGATTGGCTGGCTGTGCTCGAAAGACAGAGCACCGCCAAGGAGGCAGTCAACACT
AGGCCATACTCGGCACTGATTCCGCTGGATAGCATGGGCAAGGTCGGCTTTTCGGAGGAGTACTACAGCGTTAAGGCGGG
CAAAGGCAACGAGGTCCTCGAATTGCTCCACACTGTCTTTAAGTCGATTTTGGACATGGGCGAGATAACATGGCCCTATT
CCATAGTCAAGGGCCTAGGACTAAGCCGCGACCTGACCAGGTTTGAGAAGCTGGCAATCGAAATTGCAGACAAGAGAGAC
GAGGCAAGTCAGTCCGTTGCTCTACGAAGATATCCTGTCTTACTGAAAGAACTCACAGACTTTTGATGTCGGGAAAGCGG
ACGTCTTGTCAGGCCTGCTTCAAGACTTTCACTCCAAGGAGCCCAAGGCCTACTTCAATAGAAACATCGTCTATACCGAT
ACCCAAGTCATACTAGCTGGGGCTGTGTAAGGAAACCGCACAGTGATATACTCATCCGTTCTAATGGTTTCTGAACAGGG
ACACGATTGCCTCGACTTTGTCATTCGTGTGGTTCCATCTCGCCAAAGACCACAGAGTCCAGAGCAAGCTGCGGGACGAG
TTGGCTACGTGGCACAATACGAGCGAACAAGCGGAGTTTGCCTCAGCCGACCTTGTGAAATGCGCCTACCTCGAAGCTGT
CATCAACGAATCCATGCGAGTGGACTCGCCGACTGGCATCAACGGGGGTAGATCAACCCCTCCTGAAGGGATTTCCGTGG
ACGGTGTCCATATTCCCGGAAATGTTGTTGTGCGAGTGGGCACATATCTATATCATCGAGGTACTGAAAGAAACCCGAGC
CTTCCAAAGTTCCCAAGGTTCTGACATACTCAAGATGAGAGATACTTCCGGCAGGCCGGCGATTTCATACCAGAACGCTG
GACAACACGCCCTGAGCTAGTTCTAGAAAAGCGGGCGTTCATTCCTTTCCTCGTCGGTAGGCCAAGATCTTTCTTAGAGC
GAGAACTTATCCTCTTGATTCTGACTTATTCTCCGTCTTGGCAGGACATTGGCATTGCGTAGGCAAGAGATTTGCCTTGC
AGCTGATTCGTCTTGTTCTTGCTTACACAACTTGGCATTACGAGTTCGGATTTGCCCCGGGCGAGGACGGCACTAGAATC
TATCGAGAGAGTAGGAACAACGTCGTCATCGAGTCAGGGAAGCTTGAACTAGTTTTTAAGAGAAGAGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62