GenePrediction:GLEAN_1516 Details

Name: GLEAN_1516
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:355284..363372 (+ strand)
Length: 8089
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:355284..355574 (+ strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_82:355637..355723 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_82:355797..355839 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_82:355896..356229 (+ strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_82:356287..356812 (+ strand)
Length: 526
Type: CDS
Source: GLEAN
Position: GCSC_82:356874..357477 (+ strand)
Length: 604
Type: CDS
Source: GLEAN
Position: GCSC_82:357548..362469 (+ strand)
Length: 4922
Type: CDS
Source: GLEAN
Position: GCSC_82:362526..362867 (+ strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_82:362935..363372 (+ strand)
Length: 438
>GLEAN_1516 class=GenePrediction position=GCSC_82:355284..363372 (+ strand)
ATGGTCCTGGAATCAACTTTGACTTCAGATATGCCATTTTCGACAGCGGCTAGGCAGCGTACACCTAAAATGAGTAACGG
AGACGGGAGCAACGGGGTGGAGGCTGAGCCTGCTGGCGGAAGCATGCCTATTGCCCTTATTGGAATGAGTTGCCGATTCC
CTGGCGACGCTACCAACCCGGAGAAGTTTTGGAAGCTCTGTGCAGAGGGCCGGAGTGCATGGTCCAAGATCCCCGCTGAC
AGGTTCGACGTGAACGCGTTCTATAATCCATCCGGCGAGCAGAGAACTACGGTATGTGCCCCGAGACAGGACACGATAAT
ATTGCTGAGATGCTGACTTCTGGACCTGAAAAGACTAAAGTGATCGGTGGGCACTTCCTCAGTGAGGACATCGGACTCTT
TGATGCCACCTTTTTCAACATGACGCCCGAAGTTGCTGCTGTAAGACTAGACAAAGACAAGGCATTGGGAGAGAGTCACT
ACTAAGGCAGAGAAACAGACCATGGACCCTCAGTGCCGCCTCCAGCTCGAGTCCGTGTTTGAGGCGTTCGAGTCCTGTAA
GTAATGTTCAAACACTTCCCTTTCCAAGCACTGAACTGACCAGCTGGCATAGGCGGAGTGACGCTGGAGAAGATCGCTGG
CTCGCCAACGGGAGTCTATGCTGCGACATTTGTCAACGATTACGTGGATAGTCTTATGCGGGACCCCGACACGTTCCCAC
GCTTTCTGCTGGCGGGGAACGGTGCCACGATGATGGCCAACCGGATCTCACACTTTTATGATCTTCGCGGGCCCAGCCTG
ACGCTCGATACGGGCTGCTCCAGTGCACTGGTCGCGCTGAACCAAGCTTGCCAGAGCCTCATGCTCGGGGATGCCAAGAT
GGCTGTCGTGGCGGCTGCCAACCTGGCCATCAACCCCGACATTTTCATCCTCATGACCAGCCTGGGGTAAGTTCGGGGAC
TACCTGTTCAGTTTGCCGTAATCCGTACTCACAGCTGGCATAGGGTCCTGAGTGCCGAGGGAAAGTCGTACGCCTTTGAC
GATCGGGCGTCGGGCTATGGCCGTGGCGAGGGTATCGGCACGCTCATCCTGAAGCCCCTGAAGGACGCGTTGCGCGATGG
CGATCCGATCCGGGCAATTGTGCGGCAGACGTTCCTCAACCAGGACGGCAAGACGCCGACGATCACGTCGCCGAGCCAGC
TGGCCCAAGAAGAGCTCATCCGCGACTGCTATGCCCGGGCGGCTCTCGACCCGCTGGAGACGCCTTATGCTGAAGCCCAC
GGGACAGGCACGCAGGTGGGCGACTCGACGGAAGCGGCAGCCCTGCAGGCGACGCTCGGAAGCGGTCGTCCTCGCGGCCA
GCCTCTGCGGTTCGGCTCGGTGAAGACTAACATCGGCCATCTGGAGGCGACAAGTGGCATCGCAGCCATCATCAAGGCAG
CCATGGCCATGGAGAAGGGATTTGTGCCCCCGAGCATCAACTTCGAGACAGGGAGCAAGAATATTCCCTTTGACAAGTGG
GACATCAAGGTGAGCGAGACGTGCTTGGCGGCCGGTGTTCCGTTATCTTTACTGACGACCATGTCGACAGGTCCAGCAGC
AGCTGGAGCCCTGGCCCCAGATAGCACCACGGCGTGCATCCATCAACAATTTCGGGTACGGGGGCTCGAATGCACATGTT
ATACTGGAGGGCTGGTCAGGGGGAGTGAATGGTGCGAGCAAGCGGCCAGAATCGTCCACCAACGGAGATGCGGTGGGTCG
TACTGATTCTGGCACCGTTGTCAAGCATGGACATGGGCTGCTGCCTCGCGTCTTCGTCCTGAGCGCAAAGGACGAGAGCG
TAGGCCGAGCGATGGCGACGCGGCTGGGCGCGTATGTTGCTGAGAGTGCGCTCGAGGACGACGAGCTGCTGGGCCGCCTG
GCCTACACGCTGAGCGAGCGTCAATCGCGCTTCCCCTGGACCGTTGCGACCTCGGCAGCCAGCCGGGAGGAGCTGGTGAG
CAAGCTCTCCTCTTCGGCACCGCCGCCTCAGCGATCTGCCATGGCGCCTAGGCTTGGCTTTGTCTTTACCGGCCAGGGCG
CCCAGTGGTACGGGATGGGCCGGGAGCTGATCGGGGTGTACCCGGTCTTCACGGACACCTTGCGTGAGGCTGACGGATAT
CTTTGCGAGATGGGATCGCCCTGGTCGCTGATGGGTAAAGCTCCCCCGGCCTTTCTGATGACTAAGATCGACTAGATGCT
GACTAATGCTGACTAATCGAATAGATGAGCTGAAGAAAGACGAGACCAAGAGCCGGGTGGGCGAGGGAGCGATCGGGCCA
CCACTGTGCATAGCCCTACAGGTGGCACTGTTCCGGCAGCTGGGAGCATGGGGAATCAAGCCGACGGCGATGACGAGTCA
TTCGAGCGGCGAGATCGCGGCGGCCTGTGCAGCGGGCGTGCTGAGCCTGCGAGAGGTGATGGCGATGGTGTACGCGCGGG
GGCAGCTGCTGGACGAGCTGAACCAGCAGTCAGCGCGACAGGGCGGGATGATGGCGGTAGGTCTGGGAGCAGAAGAAGCG
CAGCAGCGAGCATCCCGGCTGAAGAGAGGGTCGGTCGCGGTGGCGTGTCTGAACAGCCCATCGAGCGTGACGATGGCGGG
CGACCAAGAGGCGATGGAGGAGCTGCGAGAGCAGCTGGAGGCCGAGGGAGTGTTTGCGCGGCGGCTGAACATGACGGTGG
CCTTCCACTCGCACCACATGGACACGGTCGGACCGGCATACCTGAAGGCGCTGCGACAGACGCTCGGGCAACCGGGCAGC
TTTGGCGACCTCGTGTACGCATCACCAGTGACAGGCAGCCGGCTGGCCGATGCGACGGTCATGGGACCTGAGTACTGGGT
ACGCAGCATTGTGCAGCCGGTGTTGTTTGTGGACGCTCTCCGGGCAGTGTGTGTGGACGAGGTCTCGGGAGGGCCGATCG
ACATGCTGGTCGAGATCGGGCCTCACCGCGCTCTGGCCGGGCCCATTCGCCAGTGTCTCCGGCTGCCCGAGTTCGGCGGC
ACAGACATTGCATACGGGTCCTGTCTGGTCCGTGGCGAAGACGCGGTGCGGACGATGCAGGTCCTGGTGTCATCGCTGGT
CGCGAAGGGCTATGCGGTCGATCTGGACGCGGTCAACTGTCCGGGCGGCCATGCGGGCCCGATGGCGATGTTGGTTGACC
TGCCGGCGTATCCGTGGGCTCACACGACGCGGTACTGGTGGGAGTCACGCATCAACAAGGCGCACCGACAGCGCCGGGAA
CCGTGTCATGATCTCCTGGGCGCCCGGGTGTTGTCGGGCGGCAACCCGTCCAACACGACGTGGCGACACTTTTTCCGCGT
GGCCGACCAGCCATGGACGCGCGAGCACGTGGTGCAGGCCGAGAACGTGTATCCCGGGGCTGGGATGATGTGCATGGTGG
TGCAGGCGATGCAGCAGATGTCGTCAGCGAGCGACCAGCAGCCGACCGGCTACCGGTTCCGCGATGTCGACATGCCGACG
GCCCTGATCGTACCCGAGACGCTCGACGGGATCGAGGCGCAGCTCTGCCTGCAGGCGGCCAGCCTAGCCATTCTCGGGCT
TCAGACCTGGCGCCGCTTCTCGCTGCACAGCACCGACGGCGACGGCGGCTGGACATACCACTGCAGCGGCCTCGTGGCGG
CTGTCGTGGAGACCAGCCCGGACAGTCCGTCGCCGTGTGCCTGTGCCACCGGCTTTTTTGTCGACACGAACCCCGGCGAT
CTGTTCCGGTACTTTCGCTCCGTCAGCATCGTCCATGGTCCCACGTTCCGGAACCTCTGCACGCTCGGCCATGCGCCCGG
CCAGGCCGTGACCGATATCGTCCTGGCCGACGAGACCGACGTGATGCCTGGCCACTACCAGCAGGACCATGTGATGCATC
CGACCACGCTCGACTCCGTCTTTGTCACCGCCTACGCCTCGCTCCCGGGCTGCGGCGCGCGCATGCAGACGGCCATGCTG
CCTCGCACGATCAAGAGCATGTTCGTCTCGACGGCCGTCAGTGCCGTGCCCGGCGACAGGCTGCACGCACACGCGGTCCT
GCACGAGCACAGCGACCAGGGCTTCTGCGCTTCCATCGAGGTGCGGAGCGGCACGGGACACGATGGTCCCATCGTCGTGC
AGGTGGAAGAGATCACGTGCCAATCGCTAGGAGAATACCGGACCCAAGACAGCCAGGACGACAACATCTGCTTCGCCGTG
CGCTGGGAGGAGGACCTTGCCCTGACGAGCCTGTCGGATCTAGCGCGCAGGCTGACGACATCGCGCAGCCGCTCAGAGGT
CAACAGCTGCAGCCGCGTGCAGCGGGCGTGTCGCTACTTTGTGCAGGACGCCCTCTCGTTCCTGTCCAGCCGCGACATCC
CCGCTCTGCCGGTCCATCTCAGGCGATACTATGCGTGGATGAAGGAACAGACGACAGGAACAGCTTCGCCCACACAGGAG
CATGACGACAAGGAGAGTCTCTTCCAAGCCGTGTCTGCCGAGAGCGTGGAGGGAGAGATGATTTGTCGCATCGGACGGAA
TCTCTTGCGAATTCTGCGCCAGGAAGTCACGGCCGAGGAGCTCCTGCAGCAAGACCAGCTGATGCATCGCTACGACGGAG
ACAGCCTTCGGATGCGTCGCTCACACCAACACGTCGCCCACCTGGTGACGCTGCTGACGCACAAGAACCCACACGTCCGC
ATCCTGGAGCTAGGTGTCGGCACGGGCGCATGTGCCGAGGCCGTCCTGTCTGTCCTGAGCAGCAGCAGCGAGAGCACAGG
GCCCCGGTTCATGTCCTATGACGTGTCCGATACCTCGTCCGACCGCTTTGACGAGGCCAGGCAAAACCTGGAGGCATGGG
ACGGTCTCTTGACCTACCGCACCCTCAACACAGAATTCGACCCGGGAGAGCAGGGTTTCGAGCTGGCATCATACGACATC
ATCATCGCACGTCAGGCCCTAGACGTCTTGGCCCCTGTGCGAAGCCTGCTCCGAGATGGCGGTATGCTCATTCAGGTCGA
GAGGACGCGCGATGCCATCGACCTGCACCTGGTCCATGGACTGCTCCACGAGTACAACCAACACAGCCCGGTCCTGGCTA
CGGACATTCGGAATGCTGCTCTTCGCAATGCCGGCTTCAGCGACCTTTGCATCCAGATCAGCGACTGCCAAGACGAGGGA
AGCGAGGCCTTTACCGTAGGCATGGCCACAGCGGTGTCTCCAGTCACGAATACGAATACAAATACAAATACAAACGCTTC
CGGCTCTGGGATTCTGCTGACGCACAGCCAACCGATCCCGCCTGCCTGGCCTCGGACATGGCTGCGCCGGCTGCAGGATG
GCCTGCGAGACGCGCAGCAGGGTGAGGTGACGGTTGAGGGACTCGAGACGGCGCAGCCGGCGAACCGGCTCTGCATCTTC
GTGGACGACGCCGAGAACCCAGTCCTGATGCAGCCGACCGAGCCGGCCTTTGCTCGCATGCAGCATCTGTGCACGACAGC
CAGCGGCGTCCTATGGATCGCACAGGGCGGTGCAGCCGGCTGCGAGAATCCCTTTGCGGCCCTGCATCTGGGCTTCCTGC
GCACGCTGCGCAGCGAACACGCCCACATCCGGTATGTGTCCGTGGACCTCGACGCCGGTCCGGATGCATGGTCTGTCGCT
GCTGCCGATGCGCTGCTCGCCATCCTGACGACTGCCTTGGACCCGTCGCGCGACCGGGCCTCGCTCGATTGCGAATATGC
CGTCCGGGGTCGTTCCGTCTTGATCCCGCGGCTCTACGAGAGCGTGACCGAGACCGAGGCCATCCGCCACCAGAGCGCCG
ACACCACCGAGCCGCTGTCGTTTGCACAGCCCAGCCGTCCGCTCCGGCTGGGCGTCGGTGCCCCCGGCATGCTGGACAGC
CTCCGGTTCGAGGACGACCCCGATGTCCACACAGACGACTTGGCCGGTGGTCTGGTCGAGATCGACCCGCAAGCCTTTGG
CCTCAACTTCCGCGACGTCATGGTGGCCATGGGCCAGCTCGACAGTCGTCTCATGGGCTTCGAGTGCAGCGGCATCATCA
CCCGGCTCGGTCCCGATGTGCCCGACAGCTTGTCCGTGGGCGACCGCGTCTGTGCCCTTCTGCGCGGACACTGGGCCACG
CGCACTTCGGTCCACTGGTCGAGTGTGGCGCGCGTGCCCGACGACATGTCCTTGGCCGTCGCCGCCTCCGTGCCCGTCAC
CTTTGTCACCGCATACTACGCCCTGCACGTCCTCGCACGCATCCAACCCGGGGACACCGTCCTGATCCACGCCGCGGCTG
GAGGCACCGGTCAGGCTGCCCTGATGCTGGCCAAGCACGTCGGGGCTGTCATCTACGCCACGGCCGGCACGCCGGAAAAG
CGCGACTTTCTAGTTGGCCGATATGGCATCCCGGCCGATAACGTCTTCTCCAGCCGCGACAAGTCCTTCGCCGCCGGCAT
TCAACAGGCCACTGCCGGTCAGGGCGTCGATATCGTTCTCAACTCGCTCGCTGGTGACCTCCTGCACGAGACCTGGTCCT
GCATCGGCCAGTTCGGCCGCTTTGTCGAGATTGGCCGCCGCGATATGGAACTCAACCGCAGCTTGCAGATGCATCCCTTC
ACCCGTGCCGTCACCTTCTCGGCCGTCGATCTGATCAAGCTCGGCGAGCTGCGCCCAGACACCGTCCATGCCGCTCTCTC
GGCCGTCATGCAGCTCTTCCGCCAGGGCGCCATCCAGCCTGTCGCCCCCATCACTACCTACCCCCTCGCCGACCTGGAAA
GGGCCTTCCGCACCATGCAGGCCGGACGCCACCTCGGCAAGATCGTCGTCGTCCCCCACCAAAACGATATCGTGCCCGTC
AAGATCCGGACCTTTCACTTGTCGCCTGCCGCCTCCTACCTGGTCGTTGGCGGCATGGGTGGCATCGGCCGTTCCGTCAC
ACAGAGACTAGTCGAGCGTGGAGCCCAGCACATCATCCTGCTCTCGAGACAGGCCGCGTCGCGCCAGAACGCCCCCTTCC
TCGAGGCTATGCGCGCTTCCGGCATCGACATCGTCGCCTTCGACACCGACATCGCAGACGGTCCGTCCTTGGCCGAGACC
ATCCAGACAGCCAAGGCCATCATGCCACCCATCCGGGGCGTCATCCAGAGCGCCATGGTCCTGCGGGTATGTCTGCAGTC
TTGTCCCCTGTGTGTTTCCTGATGACTAATCCACTTCGACAGGACTCTATATTCGAGAACATGACATGGCAAGACTGGAT
TGCCGCCGTCCGCCCCAAGGTCCAGGGCACGTGGAACCTGCATCGTCAGTTTGCCCAGCCGGACGATCTCGACTTCTTCA
TCACGCTCTCGTCCGCCTGCGGTGTCGTGGGCAACGCCGGCCAGGCCAACTATGCTGCCGGCGGCACCTTCCAGGACGCC
CTGGCGCGGTACCGCCACGCGCGTGGCCTGGCTGCCGTCTCGCTCGATCTGGGCCCGGTCGCGTCTGTGGGATACGTCGC
CGACAACGAGGCCGTCACGAACAGCCTGAAGCGCCAGGGCTTCCGCACCGTCGAGCAGGAAGAGGTGCTTCGCCTGATCG
ACCACGTCAATACGCACACCCCGACCGCCAGGGTACCCGTCCGCCAGCCAGATTGTTGTCGGCCTGTCCGTCGGTGGCGA
CATCAGCAGGGAGGACGCGCCGCTAGCCATTGACGTCCGCTTCGCCAGTTTGCGACGTATCTCGACAGCGGCCAGTCCCA
ACCGCAAAGGCGACGCCGCGTCCAGCTTGGCGAGCGCCCTCCCCCAGGCCAAGTCCTGGAATGATGCCGTCCAGGCTGTC
TGCGCTGCCATCGTCGAGAAGCTCACCCGCATGCTCACGCTGTCCGAGGCGGACATTGACGTTCGCATGTCCGTGTCCCA
TTACGGCGTCGACTCGCTCGTCGCCGTAGAGCTGCGCAACTGGATCAGTGCTTCTCTGCACAGCGAAATCTCCGTCTTTG
ACATCATGCAAGCCCGGTCCATCACTGGCCTGGCGCAGTCGACGTGTGCCAAGAGCAAGCTGGTTAGCGATAACCTCAAA
CCGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62