GenePrediction:GLEAN_1517 Details

Name: GLEAN_1517
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:377413..379134 (+ strand)
Length: 1722
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:377413..377910 (+ strand)
Length: 498
Type: CDS
Source: GLEAN
Position: GCSC_82:377989..378765 (+ strand)
Length: 777
Type: CDS
Source: GLEAN
Position: GCSC_82:378835..379134 (+ strand)
Length: 300
>GLEAN_1517 class=GenePrediction position=GCSC_82:377413..379134 (+ strand)
ATGGTGGCACGTCAAATCCTCGGAAAGACGGAGGTTCGCGATCAAGGCTCAGAAAACGGCTTGGAGGAGGAAAATGTGAC
AAAAACCAGCTGCTTGAGGCGGATATTTGTCCTCCTCAATACACTCGATAAGACGGAAGCTATCAAGGACTTCATAGCAT
CTGGCTTGAATGACTCTTCCCTACCGTTTCGCAGGGATCACAGAAACGACTGTGCTCTTTTTTCTAGATCCAAGCCCAAC
ACGCCGATACAGTTCATCTCGGATAGCTGGAAACCTCATGAGATCGAGTACTTTTATGCTAATCAGTGGTCGACGATCTC
TCCCCGCTTTTCGAAATCAAAGAGGCACAAGTCGGTTCATCATTATAAGCTATCGAAAAACGATATCCTTCCTTTTGTCC
AAGTCGATGGAAATGCGCTGCAGAATCACCACGGAGGGACAGCAGACGTCTCTCGAGTCTTCATCCACGATGATCACCAC
ACGTTCGGAGCACGAAAGGTATGCGTTGTTTCTCTAAGTTGCTTCAGCATGTATATTAGCACGTAGCGTTTTTAATACTG
ATTTTGTCAATCCCAGGACTTCGCTGGTAGTTTTGCAGTGAAGAGTCTTCGCCCGTTTTCCCCTGTTGCTTTCAAGAACG
AGGTCGACATGCTGAAAAAGTTCAGCGATGACGACGCATATCCCCATCTCATTTCCCTTCTGGCGACCTACGAGCAACAT
AACCACTTCCACATGGTCTTCGATTGGGCCGAGCGCAACCTCAAGGGCTATTGGGAGCACGTGCAGCCACAGCCCTCAGC
CACAGACCGGAAGACCGTTCTCTGGGTCGGCGAGCAGTGCAAGGGTATTGCACGTGGAATCGTCGATCTGCATCAATACG
AAACCTTCGACCGCAGTCAAGCCGATCAGTCGCCAATAGTCGTCTTTGGTCACCACGGCGATATCAAAGAGGAGAACATT
CTGTGGTTTCCTGGCACCGAAGAGCCGCAGGGTAATCCTAATAGAGGAATCCTGAAGCTGGCCGACTTTGGCTTGGCCAG
GTTCAGATCAAATAACACCAGATCGCTCGACGCGGCCAAAGGCCTCTGTGCGACACCATCCTACCGTTCTCCGGAGAGCG
ATCTGAACAATCTACAGGGTCGTTCATACGATATCTGGACCTTGGGTATCCTTTACCTTCAAATGATCACCTGGTTGCTT
GGCGGTTGGCCCCTACTACAGGATTTCACAATGAAGCGGAAGTGTCCCGACCCAAGTTGGCGTTACTGGGAAACCGACAC
ATTCTTCGAGCGCAACCCGACAGCAGAAGGGACGAGCAAAACATTGCACATCATCAAGCCAGTCGTGACCCGCGTGAGTT
GTTCTTCTCCATGCCTCTCTTCCGCCTTCTCGCCCATAACATTTCACTAACGGTCAACCTAGTTCATCGAAGAACTCCAC
CACAACAAGTCGTGTACAATATTTCTTCATGAATTTTTAGATCTGATAGCGGAGCAAATGCTTATTGTCGAGGGGTCAGA
GAAAGTGAGGATATCCGCTACAAATCTTTATGCAGAACTGAAGCGGATGGTCAAACGGTGCTCTGAAGATGACGTCTACG
CGTTAACTCCAAGCCAGTGGGGAAAGTCACAGCCTTGCGGTCACGGCCGTCCCGCCGCCGTGGAGCCCCTGAGCACACAG
AACCTTTTGAAACTGGAAAGCCAGGAAGGTCCTTCGTGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62