GenePrediction:GLEAN_1521 Details

Name: GLEAN_1521
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:390475..392022 (+ strand)
Length: 1548
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:390475..390490 (+ strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_82:390573..390682 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_82:390756..390881 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_82:390949..392022 (+ strand)
Length: 1074
>GLEAN_1521 class=GenePrediction position=GCSC_82:390475..392022 (+ strand)
ATGGTGTTCGGAATTAGTTTGTCTCACTCTCTGAAACTGCTCGAGCTATGAAGGATGAAAGAGCCCATCTAACCGTGTCG
CCTTTTTCTTCGCAACAGAACTACACGCTACCGACAGCATCTCGGACGATGCGCTCTTTCATCTCAAGAGCTACAAGTAC
TCGAGCGTGGACAAGTCACCGGTGTCCCACTACATCCTCAACCCCTACGTATGTTGGCACCTGGGTGGCGAATGCGCTCG
GTCTGATAGGCGAGAAAGGAGAGGATACTAAGACGTTGTAGTGGACTGCGGCCGTCGATCTTCTGCCATTATGGCTGGCC
CCGAACATGGTCACGCTGATCGGATTCTGCTTTATCCTGGGCAACATCGGACTGCTGCTGATCTTCATGCCTGACCTCGT
GGGACCTGTACGTGGAGTGCACCTGTGTCCGCTATTATTCCTTTCTGCCGAAGTTGCTGACACTGTCGATACAGGCACCA
TCATGGCTATACTACAGCTTTGCCTTTGGCCTGTTCATGTACCAGACGATGGACAACCTCGACGGCAAGCAGGCCCGACG
GACGGGCACCTCGAGCGGACTGGGTGAGCTCTTCGACCACGGCATCGACTCGCTGAACTGCACGCTGGCCAGCCTGCTGG
AGACGGCGGCGATGGGCCTGGGCACGTCGACGTCGGGCGTCTTCACGGCGCTGTGCCCGTGCCTGCCGATGTTCTTCTCG
ACCTGGGAGACGTACCACTCGCACACGCTCTACCTCGGCTATGTCAACGGGCCGACCGAGGGACTGCTCGTGGCCTGTCT
GGTCATGATCATCTCGGGTTACAGCGGCCCAGGCATCTGGACGCAGCCGGTGGTGGAGCTGCTGGGCGGCCACGACAACT
ACAGCGGCCCGGTGAGCAGCAGCGTGCTCTCGGCCATCGGACACTACTCGATCCGTGACGGCTGGATTGCCATCATTGTG
GTGTCGCTCCTGGTCGGCCACATCCCGTTTTGCATCGTCAACGTGGTGCGGGCGCGCAAGTCACGCGGCCAGCCGGTGGC
GCCGGTCTTTCTGGAATGGACGCCGATGGCGGTGTTTACGTGCTCGATCGGCGCGTGGGTCTACTCGCCCTACTCATTTA
TCCAGTCGGACAACCACCTGGTGCTCTTCTGCGTCACCATGTCCTTTGTCTTTGGCCGCATGACGACCAAGATGATCTTG
GCACACCTGACGCGCCAGCCGTTCCCGTACTGGACGGTGATGCTGACACCGCTCGTGGTTGGCGCCGTGCTCATCAACGT
GCCGCGGTATGGGCCTTGGGTTGGGCTGGAGCCGTTGGCGCCAATCAGCGCCCAGACCGAGCTCAACTACCTGTGGGCGT
ACTTTTTCTTCTCGATGGTGGTGTACTTCCGGTGGGCATACCTGGTGGTCAATGCGATCTGCAACTTCCTGGGCATCAAC
GCCCTGACGATTCCGCTGGAGAAACAGCAGGAGAACGAGCGACGGATGATGAAGGAGACGGCCTACGCTAGTGGCAGTGG
CCCTATCCTGAACGGTAAGACGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62