GenePrediction:GLEAN_1522 Details

Name: GLEAN_1522
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:397274..399455 (+ strand)
Length: 2182
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:397274..398195 (+ strand)
Length: 922
Type: CDS
Source: GLEAN
Position: GCSC_82:398290..399455 (+ strand)
Length: 1166
>GLEAN_1522 class=GenePrediction position=GCSC_82:397274..399455 (+ strand)
ATGGTGGAAACATTGACGCTCATGCCCATGGCTCCCGGCACGCGTTCGCGACGAGCGGACGTCCCCCGCCGCCCTGCGCC
TGTCCTGCTGCCTAAACAAAAACAGTCGCCCCTGGGGCGCCAGCAGTCACAGCGCCTAACGCGCCCACCACAGCCGCCGC
CACAGCAACCGCAGCAGCACCAGCAGCCGCGTCCGTCCCTTTCCACGGCGTCGGCGACCCGAAGCATCCAAGACATCCTC
AACCATGCCAATTCGATGCGACCCAAGCGGAAGGCAGAGCCTTCCCACGACGGCCCCGACATGTCCTCCACCGGCAGAAC
CGATTTCGACTCGGCCCAGCAGCACAAGCGTCTTCGGCTCTCCGTCGAGATCGTGTCCAAGCCCGCCCCGACCGTTCCAA
CCATCCTTCCAGCACTGCCAGCGCCAGCCACTGCGCTAACCCACCCCAACCTACCGCCGAAAAAGTCGCTGCGCACTGCC
CCTTCTTCTGTAACGGCAGCCAACACCACTACCAATACCGCTACCAGCGCTACTGCTCCCACCATCAGCACTACCGCCAC
CCTGGCTGCTCGGCCCATCTCCGCCATAGCAGCCTATTCTTCCTCCACGTCGTCACGATCAGGCAGCAGCATAACCCCTG
GCCAAGACGTCCGGCTCGCCATACCCCATCGCCACATCGGCAGCCCATCATCCAAAACCCCGTCCCAGCTGGCTGCGAAA
CCCAGGGAGAAGACGGCCAATGGCTTCAAGCAGGAACTCAAGGGCCTGCAGGTCACCACCGAGGCCGCCGTAGCAGCGGC
TACAGGCCCACCAGTAGGTGGCCGCAAGCTGCGCTCGCAGCAGGCCACACGCTTCAAGAGTGACCTCTCTGCTTATTTCC
CCGAGTACGATGAAGTCATCGGCAACGAACCCAAGGAAGAGCGTACGTACCATCCATGCTCTCCCGATCAGGACACTGGC
TTACCTGTTGATGTGACGCGCAGACATTCTGAATATAGACACCCCCATATTACTAGTCGAATCTTACTACCCCACAACAA
CTGCTACTGCCGGTGCCGTGGTGTATAGCACGCCTGTCGACTCGCTACCAAGTGGGAGCGATGTCGATGCAGTGCCTGTT
GTCCATGGATACTCTGATTCGCTCTTTTATGATCTCTTTGACTCACACGTCCTCGATTTTGGCTTTTTGAGCAACCAGCA
CAAGGGCAGGAAGACAGATGACCCACTGCCAGACTCGGTCTTTGAGCCACACCACAAGCGTGCTGAACGTCTTGAGCGCT
CCATTCGCAACTCGGAAAAGGGCCGTGCCCAGCACGAGAAAGACCAGATTATCCGCCTGTTGGAGGGCCTGCAGGGCCAT
GACTGGCTGCGCACCATGGGTGTCAGCGGTATAACGGAGAGCAAGAAGAAGTCCTTTGAGCCAGCGCGGGAGCACTTTAT
CAAGGGCTGCCGCACCATTTTGAAAAAGTTTCGCCTTTGGAGCCTGGAGGAGAAGCGGTTGAAGTTGGAGAAGGATCGCG
CACATGCAGAAGAAGTCCGCGCCCAGGAGGCGGCAGACGGCGTTCCCCCGCCACGGTATCGGGGCAGAGGAAAGGGCAAG
GCGAAGGCAGCAGCGCGTCATGTGGTCTCGGCCGTGCCAGAACGGCCAGACGGCCGGCGACGTCGAGAGCGCAGCAGCAC
AGATGCCGAAGACGGCGTGCAGGAGGAGGTAGAAAAGGCGGAAAAGGCTGAGAGGGCCGAGAGCCGAGAAGAGGCTGACG
CCGATGCCGAAGAGCCGGTCGACAATGATGACCAGTTTGATTCCAGCGACGCTGACGCGGTGATTGCCAAACAGCTGCGC
GCCGAAGCACTGGCCCGGTCGAGGCTGGCGGCCAAGGTGAATCTTCCCAGCAAGCGACGCAAAAAGCAGTTGTCGTCGCC
GTCGTCGGACTGTCCGGAGCCGGAGCCGGAGCCAGAGCCGGCTGAAGACGTCATGTCGTTCTTTCACAAGCGCTACCAGC
GCGATGCCGCTCTGAGCCGGGGTCGTCGGAAGGGTCGGACGGTCATGGCATGGGGGCAGCCGGTGCCAGAGCCGCTGGAG
GCGGATTTCGATCTGCCCGGTGAGATGATCGACGATTTGCGGGACGCAAAGGGACCTCTTCCTGCTCGCCGCAGGCGGAA
AGGAAAGCAGGAAAGTCCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62