GenePrediction:GLEAN_1529 Details

Name: GLEAN_1529
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:458610..459734 (+ strand)
Length: 1125
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:458610..458619 (+ strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_82:458686..458927 (+ strand)
Length: 242
Type: CDS
Source: GLEAN
Position: GCSC_82:459000..459734 (+ strand)
Length: 735
>GLEAN_1529 class=GenePrediction position=GCSC_82:458610..459734 (+ strand)
ATGGCTCCCCGTAAGAATGGCCTCACCTGGTCTCGCCAGTTTTCTCTATGCTGACCCTGATTGTCGCCATCCCTAGCTTC
TTCCGCCCAGTCCCTTCCGCCGTCCGTCGAGGAGGCCTACCGCAGGAAATGCGGTCTGCTGAAGCAGCGTATGGCTGATG
TCGAGGAGACGAATGATGCCGTGCGTGTGCGCCTGGCCAGGCTGAAGCGACAGGTCGAGAAGCAGCGCCTCGAGCGGGCC
TTTCTTCTCGAACAGCTCGCCAAGCGCACCAGCGCCAATGTGGAGGATTCCGATGGCAGCCCGAGCCCGCCTCCGACCGT
AAGCCCTCTCGACCGCTCTTCGCGTGGCCCTTTATTGCTTCTCTAACCCTGTTCCTTTCTTGTCTGACAGCCGAAAGACA
AGCCTCTGAGGACGAAGCGTGGACACAGGAAAGCCTCGCTTACCGGCATCGGCGGCGAGCCCGGCTCGACTGCCACGACC
TTTATCAACCAGAACCTACAGGCGCAGTCACCGAACTCGGATGCGGCCAGCAACCATGTGGACAGCCAGACCCTGGAAAC
GCAGGGATCGGCCAAGAGCGGCGGCAAGGGCAAGGACAAAGTCAAGGACAAGAATAGCAAGGTCGACGGCGGAGACAAGG
ACAAGGACGGCGCCAACGGGATGGCCAAGGGACCGCTGAAGCGGCCAGTCAACGGCTTCGAGCTGTACTGCGCAGAGGTA
CGACCCGGCCTGGCCGAAAAGAAGCAGGAGAAGGCCAAGATGGGCGGCGGCGACGAAGCGGACGATGTCGACATGGAGGA
CGCTGTCGAGTATGGCGCGGGCAGCAGCAGCATCGAGGCCGATCTGGCCCGTGGCTGGACGGACATGCCTCAGAGCCATA
AGGACGAGTTTGAGGCACGCGCAGCCGAGGAGCTGGCGAAGCACAAGAAGGCCAAGGAGGATGCGCGGCAGCAGAAGCAA
AAGGACAAGGGAGACGACACCGAGAAGGAGGGTGAGCACAACGCCGAAACCGAGGATGCCAAGGCCGGAGAAGAAAAGAA
GGAATCGGCCAAACGTGTCGTCAAGGAGGAAGACACGGAGATGGCTGACGAGAATGCGGCGCCGTCGATTGACAGCAAGG
AATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62