GenePrediction:GLEAN_1530 Details

Name: GLEAN_1530
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:464916..466029 (+ strand)
Length: 1114
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:464916..464926 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_82:465018..465056 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_82:465375..465414 (+ strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_82:465490..465502 (+ strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_82:465583..465632 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_82:465739..465778 (+ strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_82:465844..465865 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_82:465966..466029 (+ strand)
Length: 64
>GLEAN_1530 class=GenePrediction position=GCSC_82:464916..466029 (+ strand)
ATGACGAAGCGGTATGGATATGATACCCGTTCTATGGCTATACTGTGGCTTTCGGCCTCTAGGCAGCGGTGTTGAGCAAA
TGCACTGACATTCGTTATTTAGCACGAAGAAGGTCGGCGTCACTGGCCGTTACGGTACCAGGTGAGATGCGAACTCTCCC
CCTTTTCCCAGCGGTGTTTCGAAGATGGATGAAAGAGGAGGATCGGTCAAGAGCAGCGACAAGCGAGCACCATTCGAGCA
AACGTCGGACGACGAATAGCGACGAAAATATGCATGCAGCCAATAGCTCACTCAGACGATCCAATGGCTAGAAGTGCCAC
GACTTTTCTCAGCATGGCCGGAGACTTTTCATTGTGCTCAGCAGACGACATCGAATGGTCCGAAGAGGAGAAATGTCACC
GAAGGAAGAGATGTTACCGAAGGAGGGAGATGGCTTTACTGACACTATTGCTCAATTAGATACGGTGCTTCCCTCCGCAA
GCAGGTGAAGAAGAGCGAAGTAAGTTGATATCAAGCTTCTGCTGCCTGCTTGCCGCTGAGTTTTCTTAATAAATGCTGAC
ACTTATTCTCTTAGATCACCCAACATGGTGCGTGAACGATGCCTCTGTACTCGAGACGGCTGATCGCCTGTCTCTTGTCG
CGAAAATATAACTCACACTCGAAATAGCTCGCTACATCTGCGCCTTTTGCGCCAAGAACACCGTGAAGCGGACCTCTGTT
AGTGTCCCCTCAGACTCCTTCGATGCTGCTGCATAGCTGCTGCTTCGCCTGATGATACGGTATTTTTGGTTAAAAAGATA
CTAATATGGTTGTTGCTGAATAGGTCGGCATCTGGCAGTGCAAGTCTTGCAAGAAGTGCATTGGTACGTTTTTTCTTTTC
TTTTCAACCTTCCCAGACTTTTACTGGACCAATACTAACTTTTCATAGCTGGTGGCGCTTACGTCGTCTCGTATGTTTAT
TACCACACACAAGCCCCGGGACCTTCATACCACCAACTTTGAGCCACGTCTCTGACTACTTTCGACGGCGTACTAATTAT
TGCTTCACAGGACCCCTGCCGCTGCTGCTACGCGGTCGACCCTGCGGAGATTGCGCGAGATTGCCGAGGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62