GenePrediction:GLEAN_1531 Details

Name: GLEAN_1531
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:467712..469901 (+ strand)
Length: 2190
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:467712..467931 (+ strand)
Length: 220
Type: CDS
Source: GLEAN
Position: GCSC_82:468061..468084 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_82:468199..469901 (+ strand)
Length: 1703
>GLEAN_1531 class=GenePrediction position=GCSC_82:467712..469901 (+ strand)
ATGGCAGAACAGTGCATAGTTTGCCTAGACCCCTTACTGCACGCTGAAGAACCCCCACCACCGCCCGAAGAAGTGAAGCC
TGCCCCTAACAGCCCCAATGCTACCAGCGCCATAGCGAGCGGCGCTATTATCGGTGATACTACCAACAATACCGGGCCGT
TTAAAGAGGATGCTGATGGTGCATCCCATCCCCGATTGCAAGCTGCCAGCGACAGCGGTGGTGTTAGTCACGGGGATGAC
AACGTCGCTGTTATTCAAATTTGCGGGCATACTCTGCATGATACTTGTCTACGAGAATGGTCGGGCAAGGCCAACAGCTG
TCCAATCTGTCGGCAGACGTTCCACTCAGTTTGTGTATATGACAAAATCGGAGGTTCGTACCCACCACCAGATGTTTCTC
TGCCTCGTAGTTCGGCTACCCGTATAATACCGGGCTGTTATCCCGTCTGTGGCTTTTGACAAAACTAACTCAGGACTCTG
CAAATAGGCAATCTACTGTCATCTTACAAAGTCCAAGATAAGAAACAGGTCGCCGAATTTGACCCACAGGCATGGCTGGA
CGAGTTTGCAGAGGTCGAGGCCGATGACATTTCCACTCCTTGTCCAGTATGCAACCTAGCCGACAATGAAGAAGTCCTAC
TTCTCTGTGACGGGTGTGATACCCCGTATCATACCCACTGCATTGGCCTCGAGAACGTGCCCCAAGGCGCCTGGTTCTGT
ATGGAGTGCATCGATCTCCTTGGCCAAGCCATCCCGGGTGCAGCTACCGATGGGCAACTGTTTGCCGGTGCACCGCGCAG
GCTAGGCCCCCAGCGGGCGCGGAACGACTTTTTCCCCCGCACCAGGCAGAGCATGCGGCGTGCGAGACGGCGTGCCCAGT
CAGACGAGTGGCAGGGCGCCTGGGGTCAAATCACTGGGCGGATCTGGGATGTGCTGAACATCGACCTGGACCACGACGAG
GACGAATCTCTGGAGGATTATCGTCGCGCCGAGCAATTGAGAAATAACGAGCGTCGGGAATTCGAGCGCTGGCAAGAGAG
GCTGGACATAGCCCGTCGTCTCGGAGCACAAGATGTCTTTGAGCGAAACATACCAAGCGCCATATTGCAGCGCGGAGGCC
GACACACTGCTGCATCGCAGAATGGACGCGTACAGACGGCAACGGTCCAACAGAGCCGCGAAGAGATCAGGTCGTGGGGT
GCTTTTGAGAGAGCACGGGACTGCGACGTAAGCAGCCAGGCTGCTCGGAAACGCAAGGCTCGATCTATTACCGCTTCTCC
TGTGGAGCCCGTTCAAGAACCGGAACGAAAGCTGAAACGGCCTCGCACTCGTCGTATCACGGCACCCCCCGGCGAACCGT
CCTCTTCCAAATCGGCAGTACCTGGATCGAGCAGCGATGCTCCAGCTGCCATATCAGCTATCGCGTCGGGAAGCAGCAGC
TCGGCTGCAGCAACACTACCGTCCAGAACGCCTCAGACCGACGGCGAGCCTCGCTCTTTTCTGTCTTCGCTGCTCAAAGA
GGTCGAGTCGAGCACACCTTCTGACGACGAAACCATCCGCAACCTTTTTGGAGAGCCTCGGCCTAGCCTCGTAATCGACC
CGTCCTCCCCAGTCGCCTCATCGCCGGCTGCCTCGCCACATAACAGCCCACGGGCAATGTCGACTACACCACCGCCACAC
CGAGCACTTAGGCCGAGCTCGCCTACGTTGTTGAGCTCCCACATCGAACCAATATATCCACCAGCAAACTACTCACCAAC
ACGATCAGCAGTCAGTCCAAGAAGCGATCACAGTGATTCCGAAAACAACAATGGCAACATCAGCAGCTTAGTAAATCAAG
CCAGTGCTAACCACAACGGCTCGACATTTGTTACGGAGCTTCGGCAGCCACGTCCCCAGAGAAGGCCGACCATAGCGCTG
CCGCGATCAGAAGACGTATCGCCATCACGGAATCCACTTTCGCTCGAGATGAAGGAAAGCATCAGCAGTATCGTTCGAGC
AGCTTTGAAGCCGCACTGGAAATCCAGTCAGCTCACCGCCGACCAGTATGCCGCTATCAACCGCGACGTCTCCCACAAAC
TTTACGAGGAGGTGAGCAACCCAGTGGCTGCCGATTCGGAAACGCGGAAGCTTTGGGAGAAGAAGGCATCGAAAGAGGTG
GCGCAAGCAGTTGCCGACCTATCGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62