GenePrediction:GLEAN_1532 Details

Name: GLEAN_1532
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:470814..472095 (+ strand)
Length: 1282
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:470814..470862 (+ strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_82:470969..471750 (+ strand)
Length: 782
Type: CDS
Source: GLEAN
Position: GCSC_82:471823..472095 (+ strand)
Length: 273
>GLEAN_1532 class=GenePrediction position=GCSC_82:470814..472095 (+ strand)
ATGGCGGCCACAAGCAGAGGCGGACAGGCAGTTTCTGCCCTGTTCCACGGTACGTCTTGTTCCCCTCGTGCCTTTCTTCA
GCCTCCCATTTCGTGGTCCGAAGACGGGAGGATATATGTATAGCATGGCACCACGTCTCTGACATGCCGCCGCAGCACAA
TCCCGAACGGCCAGCTGCGCTCGCTGTGCACAAACCCGTAGCAGTCCGTTCTTCTTCAGCTGGCCGGCCACATCACGGCG
GTTGTACTCGGCAGCCGCCGCAACAGAAGCGGAGCCGTCCCCATCACCACCCTCCACAGCTGCCGCAGTCGCGTCAAGAG
AGGAACCCGTGGCAGTCTCGCACCCGGGCTTTCGCATACGGGCTGGGCTGCTGCTCAGCCGGCCGCCACTGCTGACCCGC
GAGCCGACCGCGTTCGAGTCGGCCTTTTACCTCTATCAGAAGCGCCTCAACGAGCGGCTCAGCGGCTCCTTCCGGAAGAA
CGTCTACTTCAAGCCTGACACTACCCCGGCTCTCGACTGGCGTCTACAGCTGCGCGATCGACGCGGAACTCCTGCCCGCG
ATATTGGCAGCTACGAGGGTGGCAAGGGTGGCCACGGCCGTGGAGGCGCCCGCGCCTGGGACGATGAGCTCACGCTGGAC
GACCCCCTCGCCACCGAGCTCACCCAGCCCGATCGCTTGCGTGAGCGCATCATCTCGGATGCTGATCTGCGCGTCAGCGA
GGACGGCGAACGCCTCAGCGAGGCAGACCGTGTCCGCGTCGAGCGGCCGCAGCCTCGCACCACCGCTGCCGACGGCGATC
TCACCACCGGAGAAGGCGCCAATCCTCGTCGTCTTGACCGTCGCCTGGACCGGACCCTGTACCTCGTCGTTCGTGGCGCC
GACGGCACCTGGGGCTTTCCCACGGCTGATGTGCAGACCAACGAGAACTTGCACGAGGTATGTTTGTGCTGCGACTTGGT
TTCACGCCTGCTTACTAATTTTGACATAATTACTAATCATCGCGTTCAGACGGCTGCTCGGGCACTGGAATCCGCTGCTG
GTGTTGACATGAACACCTGGATTGTCGGCCGCGTGCCTATTGCCCATATTGTCCAGTCCACAGATGCCACTGATGGCGAG
AAGACCTTCTTCCTCAAGGGCCGCATCATGGCCGGTCAGGCTAATCTAGAGGGCAACACCTCTGGCCTCACCGACTTCAA
ATGGCTGACCAAAGAAGAGCTCGCCAAAGAGCTCCCATGGTATTACTATTCGGGCGTGAAACACGCAATGCCAGAGAGGT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62