GenePrediction:GLEAN_1533 Details

Name: GLEAN_1533
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:475478..476506 (+ strand)
Length: 1029
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:475478..475515 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_82:475649..475719 (+ strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_82:475784..476401 (+ strand)
Length: 618
Type: CDS
Source: GLEAN
Position: GCSC_82:476478..476506 (+ strand)
Length: 29
>GLEAN_1533 class=GenePrediction position=GCSC_82:475478..476506 (+ strand)
ATGGCTCGTCAATTTTTCGTCGGCGGCAACTTCAAGATGTGAGTGGTCCCGCGTCTCCTCTCCGAATACCCCGCGATCCT
ACCTGCTTGTTCCTGAAAAGAAACCCCGCAAATATGCGAATAGCTTCAACGGGTTTCCACCATGCTGACCACCACTTGCG
GCAACATCTAGGAACGGGACTGTCCAGTCCGTCAAGAAGATTGTCGACAACCTGAACGAGGCTACGCTAGACCCCAACAC
TGGTAAGTGAAAAGCCCGAACTTGCTCTAAGCCTGGAAGATTGTTCTCACACACGTTCCCGTCCAGAGGTCGTCATCGCC
CCGCCTTCGCTGTACCTTTCGCTGGTGCGCGAGAAGCTTAGCGACAAGATCGAGGTGGCAGCCCAGAATGTCTACGACAA
GCCGGACGGCGCGTTTACGGGTGAGATCTCGGTGCACCAGCTGATCGACTCCAACATTACGTGGACCATTTTGGGCCATT
CGGAGCGCCGCAGCCTGTTGGCCGAGTCGGACGCGGTCGTGACGTCCAAGACCAAGTACGCTATCGCCAACGGCCTCAAG
GTCATCTGGTGCTGCGGCGAGTCGCTGGAGCAGCGCGAGAAGGGCGAGACCGTGGCTGTGGTGACGGGCCAGCTGGCGGC
ACTTAAGGCGAGCCTCGGCTCGGACGCGGCCGTGTGGAAGAACCTGGTGATCGCATACGAGCCCATCTGGGCCATCGGCA
CCGGCAAGGTGGCCACCACGGCACAGGCGCAGGAGGTCCACGTGGCCATCCGCGGTTGGCTCAAGGAGAACGTCAGCGCC
GAGGTCGCCGAGGCCACGCGCATTCTGTATGGCGGCAGCGTCAGCGAGAAGAACTGCAAGGACCTGGGCAAGCAGCCCGA
CATCGACGGCTTCCTGGTCGGCGGTGCCAGCCTGAAGCCTGCCTGTGAGTATACCCCCCCTTTTTTGTTAGGCTGCCTGT
GAGTAGCTGTGCCCTGCTTTATACTGACTGTCCTTACTAGTTGTTGATATTATCAACAGCAACCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62