GenePrediction:GLEAN_1535 Details

Name: GLEAN_1535
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:484345..485868 (+ strand)
Length: 1524
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:484345..484522 (+ strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_82:484595..484703 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_82:484758..485868 (+ strand)
Length: 1111
>GLEAN_1535 class=GenePrediction position=GCSC_82:484345..485868 (+ strand)
ATGAATCTCCTCCTCTCGGACGACTACTTACTGCAAGACTACCCTGAGAATATCACCAACACCATCCGCTCCGGCCATGC
CACCTGTCTACGTTTCAATCGCCGAGGCGATTACCTCGCCTCGGGACGTGTCGACGGAACGGTTGTCATTTGGGACCTCG
ACACCATGGGTGTCGCGCGTAAGTTGCGCGGACATTCACGAAGCATATCGTCGTTGAGCTGGTCGCGTGATGGTCGCTAC
CTCCTGTCAGCTTGCCAGGGGTGGAAAGCTATTCTCTGGGACCTACAAGATGGCCGCAAGCTACGCGAGGTGCGTTTCCG
AGCGCCGGTTTACATCGCCGAGCTACACCCATGGAAGATGTAAGTAGGACCTACTCACAGTACTGTTTGGTGACAGAGCC
GCTGACAAGTCAGAACGCACTTTGTCGCATCCCTTTACGAGGAGCAGGCGCTGCTCGTCGACATCACCGAAGCCATCGAC
GTGAAGCACGTACTACCCTCGAAACCGAAACGAGCCGAGACGGACGACGCGACTTTGCGGGAGAAATGGGCCAAGGAAGA
TGCCAAGCAGATGACGACAGTGACCGTGTACGCGGCATCCGGAGGACACATAATATCGGCCACGAGCAAGGGCTGGATCA
ACATCATCGACGCGACCACCCTCGAGGTGATCTTTTCTAAAAAGGCCTGTGGCAGTGTCGTCACGACGCTTCGGCTAAAT
GGGTCTGGAAAGATCCTGCTTGCCAACGCACAAGATCGAATTATCCGCTCTTTCTACATGCCCAATCTGGCAGCCCCTGA
CCTCGATCCGGACACCATCCAGCTGCCCGAGGAGCACAAGTTTCAGGACGTCGTGAACCGGCTTTCATGGAATCACATAG
CGCTGAGCCCGACTGGCGAATACGTCGCCGCCTCTACGTACAACAACCACGAGCTCTACATCTGGGAGCGCAACCACGGC
TCGCTTGTGCGTATGCTCGAGGGTCCAAAAGAAGAACAGGGCGTCATCGAGTGGCACCCACACCGCGCATTACTGGCCGC
GTGTGGGCTCGAGACCGGACGTATTAACATTTGGTCAGTCACCAGCCCGCAGAAATGGTCAGCACTAGCACCCGACTTCG
CCGAAGTGGAGGAAAACGAGATCTACGTTGAGAAGGAGGACGAGTTCGATATACACCCACAAGAGGTCATCGACAGACGC
CGTCTGGACCTCGAGGATGAGGAGGTCGATGTGCTCACCGTTGAACAGACGGGTGCGGATCTCCTGCTCGATGGTGCGGC
TGCCATTTTCGGCCAAGGTATCGGCGGCACAAACAGCAACACTACCTTCCGCATGCCCATCTTGTACGACCTGGGCGAGT
CTGACAGCGAGGAAGAGTTTATCACCGTGTCGACAGGCACCATGCGCCGCAGAAGTCTAGGGGACGGTGCAGCAGGAGAT
CTAGACGGAGATGGCGCCGGCAGCGAGGAACGGCCTGGCGGGACAAAGAAAGGCTCGAGAGGGGGCCGACCAAAACGGAA
GTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62