GenePrediction:GLEAN_1536 Details

Name: GLEAN_1536
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:487258..492665 (+ strand)
Length: 5408
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:487258..487614 (+ strand)
Length: 357
Type: CDS
Source: GLEAN
Position: GCSC_82:487726..492549 (+ strand)
Length: 4824
Type: CDS
Source: GLEAN
Position: GCSC_82:492609..492665 (+ strand)
Length: 57
>GLEAN_1536 class=GenePrediction position=GCSC_82:487258..492665 (+ strand)
ATGGCGAACCTATACTTTGCGCACTCGAGTGCGCCCCTCAAGACGATTGAAGAAATTCAGTTCAGCATGATGTCACCGGA
GGAAATAAAAAACCTGAGTGTGGCTCATATTGTCTACCCTGAAGCAATGGACGAGACGAAGACCAAGCCGCGTGATGGCG
GTGTGAACGATCCACTGCTCGGGTCCGTCGACCGCCAGTTTAAGTGCAAAACTTGCACGGAGAACATGTCGGAATGCCCG
GGTCATTTCGGCCATATTGAGCTAGCTAAACCTGTGTACCATCCTGGCTTCATCAAGAAGACCAAGAAGGTGCTTGAGAT
TGTTTGTCACAACTGCAGCATGGTGCTTGCCGACAGGGTTAGTGTTACCTTGAGGAAGCTCTCAGATGAGGCGGTTGACA
TCCGTTTGGTACCCGTTTTTTCTGTGCTAACCTCATGATCCTTGTTACCCATCTTGCCCGTCCTATAGAGTGATCCAGAA
TTTGTTGCAGCCGTCAACACAAGAGATCCCAAGGCCCGGTTCCAGCGCGTCTGGGAGTGCTGCAAGAAGAAGAGGCGATG
CGAGAACGAGGCAAAGGCCGAAGAGGAGGAGTTCGACCCCAACCCGAGCAAGATCGCGAAGCAGCAGCCACACAACCATG
GAGGATGTGGCAACATGCAACCGGCGGTGCGCCAGACAGGCCTACAGTTGTGGTCACACTTCGAGGTCGAGCGCGATGAG
GGTGGCAAGACGAAAGAAAAGAAGCTTCTTACTGCTGAGGTGGCACTGAACATTCTCCGTCGGATCAGCACTGCTGATAT
CCGTGACATGGGTCTGAATGTTGACTACGCTCGCCCGGAGTGGATGGTTCTGACCGTTCTTCCCGTTCCCCCACCGCCCG
TTCGGCCCAGCATCTCCATGGATGGTACTGGAACCGGTATGCGAAATGAAGACGATTTGACCTTCAAGCTGGGTGATATT
ATTCGCGCCAACAACAACGTCCGGCAAGCTATCAACGAGGGTTCGCCTGCTCACATCTCATCTGATTTCGAGCAATTGTT
GCAGTACCACGTTGCGACATACATGGACAATGACATTGCCGCTATTCCTCGTGCTCTTCAAAAGAGCGGACGTCCTGTCA
AGTCTATCCGTGCCAGACTCAAGGGCAAGGAGGGTCGTCTGCGTGGTAATCTGATGGGTAAGCGTGTCGATTTTTCAGCA
CGTACCGTCATCACAGGTGACGCCAACATCTCGCTTGATGAAGTTGGTGTTCCTCGCTCCATCGCCCGCACACTCACATA
CCCTGAGACGGTGACGCCCTACAACATCGGTCGTCTACACCAGCTCGTGCAAAACGGTCCCAACGAGCACCCGGGAGCCA
AATATGTCATAAGATCTGATGGTACCCGCATCGATCTTCGGCATCATCGTCGGGCTGGGCAAATCTCGCTCGAGTACGGC
TGGAAGGTGGAGAGACATCTGATTGACGGTGATTTCATCATCTTCAATCGTCAGCCATCTTTGCACAAGGAGTCTATGAT
GGGCCATCGTGTTCGTGTCATGCCATACTCCACATTCCGACTCAACCTCTCCGTGACGTCGCCATACAACGCTGATTTCG
ACGGTGATGAAATGAACCTGCACGTGCCTCAAACTGAGGAGACTCGAGCTGAAGTCAAGGAGCTTTGCATGGTGCCACTC
AACATCGTGTCTCCACAGCGAAACGGCCCACTCATGGGTATTGTCCAGGATACACTCGCAGGTGCCTACAAGCTCTGCCG
GCGTGACGTTTTCCTGTCAAAGGAGCAAGTGATGAATATCATGCTTTGGGTACCGGAATGGAACGGTGTCATCCCTAGGC
CGGCCATTCTCAAGCCTCGGCCTCGTTGGACTGGAAAGCAGATTATGAGTCTGGTTATCCCGAAGACGATAAACTTGCGC
ATGGGGAATGACGACACGGCACTTAAAGACGACGGCCTGCTCATTCAGACCGGTGAGCTGATGTATGGCTTGCCGACAAA
GAAAAGCGTTGGAGCCTCTGGTGGCGGTATCATCCACATTTGCTTCAACGAGCTCGGATCTGATGGTGCGATGGCTTTCT
TGAACGGCTGCCAACGCGTCGTGAACTACTGGCTGCTCCACAACGGCCACAGCATTGGTATCGGCGACACAATTCCCGAC
AAAGCCACGATCGAAAAGGTGCAGGAGCAGATTGATACCCAGAAGGAGGAGGTGCGCCGACTCACGGCAATGGCTACAGC
GAATGAGCTGGAGGCCTTGCCTGGTATGAACATTCGGGAGACCTTTGAAAATAAGGTGTCGAAAGCACTGAACACCGCTC
GCGACAAGGCTGGTACTACGACTCAAGAAAGTTTGAAGGACATCAACAACGCCGTCACCATGGCGCGGTCGGGCTCTAAG
GGCTCCTCTATCAACATCTCGCAGATGACTGCGTTGGTCGGTCAGCAGATCGTTGAGGGCAGACGTATTCCCTTTGGATT
TAAGTACCGGACTCTACCACATTTCACAAAGGACGATTACTCGCCTGAGGCTCGTGGCTTCGTGGAGAACTCCTACCTGC
GTGGTCTCACGCCGACCGAGTTCTTTTTCCACGCTATGGCCGGTCGTGAGGGTCTTATCGATACTGCGGTGAAGACTGCG
GAGACGGGATACATTCAGCGGCGGCTGGTGAAGGCACTTGAGGACGTCAGTGCCAAGTATGACGGAACTGTGCGAAACTC
TCTGGGCGACGTCATTCAATTCGTCTACGGCGAAGATGGTCTTGATGGTGTCCATATCGAAGAACAGCGCATGGACCATC
TCAACATGTCCATCAAATCGTTTGAGAAGAAGTTCCGTCTGGACGTGATGAGCGAGATGCGGCCTGCGGCGCTTGATGCA
CTGGAGTACGCAAACGAGATCGCTGGCGACGCGGAAGTACAAGAGCTGCTCGACAGCGAGTACGAAACATTATTGGGCGA
CCGTGAGCGGGTTCGCGACATCAACAAGAGACGCCTGAGCAGCATTCTGGGCAAGAAGGATGAGGAGATGATGCAATTGC
CGCTGAACGTGGTGCGCATCGTCAACACGGCTCAGAAAATGTTCAAGCTGGATGATGCCCAGCGAAGCGACCTGCGCCCT
CAAGATGTTATTCCGGTGATCCAGAAGATGTTGAATCAGATGGTGGCCGTCCGCGGCAAAGATGCCATCTCGGTGGAGGC
GAATGATAGTGCGACGATTCTGTTCAAAGCGCAGCTCCGGTCACGGCTAGCCTTCAAGCGCCTCGCAGTTGAAATGCGCC
TGACGCGCCTGGCCTTTGATCATATTGTGGGCGAGCTCAGCAGCCGTTGGGCACGGGCGATGGTGAATCCGGGAGAGATG
GTGGGTGTTTTGGCAGCCCAGTCGATTGGCGAGCCGGCCACGCAGATGACGTTGAACACGTTCCATTTCGCCGGTGTGTC
GTCGAAGAACGTGACGCTGGGTGTGCCTCGGCTCAAGGAGATTTTGAACGTGGCTAGCAACATCAAGACCCCGTCCATGG
CTGTCTACTTGGACGATGCGGACGAGCGACCACCAACGCAAGACAGAGCCAAGGAGCTACGAAGCATTGTGGAACATACC
AATCTGCGGTCTGTGACAGCGGTGACGGAGATTTACTATGACCCGGACCTGCGGTGGACCAACATTGTGGAAGACGAGAA
CATTCTGGAGTCCTACTTCCTGATTCCGGAGGACGTGGCCACCAACCTGGATCAACAGTCCCGGTGGATGCTGCGTATCA
CGCTGGATCGGCAGAAGCTGCTCGACAAGGGCCTGACCATTGAAGACGTGGCCAACCGCATCAAGGAGGAGTACCCGACG
GACTTGGGTGTCATCTTCAGCGATAACAACGCTGACAGCCAGGTGATTCGGGTCCGGACCGTGCGGCAGGACGACGAGAA
AGACGAGGACGGCGCACTGGAAGACGACGTGATGCTGAAGCGACTCGAGACACATTTGCTCGACACGCTAACGCTACGCG
GAGTGCCGGGCATTGAGCGGGCCTTCCTGAACAAGGACACGGTGCTGATCAAGACCAAGGACGACGCGCTGTTGGCTGCC
AAGGATGACCCTGCCTGCACGGCATGGTACCTCGACACAGAGGGTTCTGCTCTTCGTGCCGTCCTAGCGGTCGATGGCGT
GGACCCGAAACGCACGTACACAAACGACCTGCATCAGGTTGTGGACGTGTTCGGTATCGAGGCTGCGCGGTCGACGCTGT
TGCGTGAGCTGACTGCGGTCCTGTCGTTTGACGGTTCGTATGTCAACCACCGCCATCTTGCTCTGCTGGTGGACGTGATG
ACGTATCGCGGTAGTATCGCGGCGGTCACGCGCCACGGCATCAACCGTGCTGACACGGGTGCCCTGATGCGCTGTTCCTT
TGAGGAGACGGTAGAGATTTTGCTGGAGGCAGCAGCTGTGGGCGAGCTTGACGATTGCCGCGGTATTTCGGAGAACGTGA
TGCTGGGCCAGCTAGCGCCCATGGGCACGGGTCACTTTGAGGTACTGCTGGATCCGAAGCTGCTCGAGACAGTGATCATG
GACAATTCCCGCATGGGTCTCATGCCGGGTCTCACGGTCAAGGGCAGTCAGCTGGAGGGTGCAGCGACGCCTTACGACAC
CGGGTCACCGCTAGCCGACTCGGGCTATCTCAGCATCAGCTCGCCAGCTATGGGCAACTTCTCGCCCATCATGGGTGCCG
GCTCCGAGACGCCTGCAGGTCTCAACACGGAGTACGGTGGCAGCGGCTTTGGCAGCATGGGCTATGCAACCAGCCCTCGG
CCGACGAGTCCGTTCACCACGTCGCCGACGTCGCCGTTCAACAGTGGCTATGGAAGCTACTCACCGACGTCGCCTTCGGC
CGGGTACTCGCCGACGTCGCCCATCATGGATATGGGTGGCCGTTTTTCGTCGTCGCCGCAGTTCAGCCCGTCGTCGCCTT
CGTTCTCGCCGACGTCGCCGATGATGCGGCCAACCAGCCCCAACTACAGTCCCACGTCGCCCAGCTACTCGCCGGCTTCT
CCATCGGCAGCGCGTCACTATTCGCCTACTTCTCCGGCGCAATTTACCTCGCCAACCTCGCCGTCGTACTCTCCAGCAAG
CCCCAACTACAGCCCGGCATCGCCCAATCTCCATGCCACGTCTCCGTCCTACTCGCCGGCCTCTCCTACTTGGTCACCCA
CGTCGCCTGAAGCCTACTCTCCAACGAGTCCGACGTTCCAACGGTCTCCTGGACAGGCTGCATCGCCTACTAGCCCGAGC
TACTCGCCAACGGTAAGCGCTGAAAATGGAAAGACAAAAGTCAAAATCAGGATATATACTAACTATGACAGTCGCCAACG
TTCTCTCCTCGGACCCCAGGACGCGGCCCGCCAGGGCCGGCTTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62