GenePrediction:GLEAN_1538 Details

Name: GLEAN_1538
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:497808..500911 (+ strand)
Length: 3104
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:497808..498045 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_82:498134..499497 (+ strand)
Length: 1364
Type: CDS
Source: GLEAN
Position: GCSC_82:499569..500189 (+ strand)
Length: 621
Type: CDS
Source: GLEAN
Position: GCSC_82:500266..500394 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_82:500492..500911 (+ strand)
Length: 420
>GLEAN_1538 class=GenePrediction position=GCSC_82:497808..500911 (+ strand)
ATGGCTTCGCCATCCGCCAGCTCTGTGGCCTCGTTCCAGACGGCTCGTACGACGTCTCCGTCAACAAATGGCCAAAATGG
AAGAGAGACAGGCTCTGGAAGTGGTGGTGGTAACGATGCTCGTGAGACCGCAGCTGTTGGGGCCGAAACGGGCAGCTTTA
CAAAGCTGTATCGACCGGTGAGACAGCTGCCATATGAGCTCAAAGGCCACGTTCGGGTGTTTCTGGAAGAGCGAATGTGT
GAGTACAGAGAGCATGGAGACAGAGAAGCGGAGACGAGAAGAGGCGTGCTAGCTGACAGCCGGGCGGAATGCTCGCTGCC
AAACAGACAGCGAGGCCATCCAGCTTCTGACTAGCCTCCTGGCAGCGGGAGGTTCTGAGCGAGGGATCGGACAGCCGGTC
TGGATTCCACCGCCCAGTCATCTGGCCGTGCTGGCAACGTTGATGGTGCACCCGGCCTACACGAGCCGCACGCAGGAGAA
CACGGACCTACGGGTGGCCGGCCATGCGCTGCAGTACCTGCGTCACATCCTGGCGGTGGCAGGGCCGATGCAGCCGGGCT
TCCGGACGGCCTTTGCGTTCCGGGACGTGCGGGGACGAGGAGGTGGTAGTGGTGCGGCGTCTGTGGGAAGCGGTGGTGCG
AATGCGAATGCGAGTGCGAGTGCCAATGCGAGTGCGAGTGCCAGCCGATCGCATTCCCGGCCGCGTCGGCTTAGAGCGCT
GGGTGCGCGGTCGGGCATCTTTGGCGGCAGCGGTGCCGGTGGAGGTGGCAGCGGCCACAGAGACTACGTCGACAGCCGGA
CGCTCAAGTTTGACGACGACGACAACGAGCGGGCCAGCGCCGTTCTCGCGGCGGCCGGCATCAGCGTCGACACTCTGGCG
ACCACGGCCAGCAGCCGCGATGGTGCAGCAGATGCCGATGTGGGTGCGGCTTTTGATTTTGCACACGGCCTCGATGTAGA
CACGGACATGGACGCGGACGAAGACGCGATCAGCGGGCGGATGGCCACGCGGGACAGCGTGTGGACGCGCGGACAGGACT
TTTGGCGGGTGGCCGGCTGGGCCCTCAGCTGCAGCGTGGAGGCACCGCTGCGGTGGCGGTACTGGCAGGCATGGATGGTC
CTCGTGGTCGACGTGCTCGAGGCAGACCTGGCCGCACGGCTAGGCGAGGAGCACGCACAGGGCGGAAAGGGGACATCGCC
ATCGGGACGAGAGGCTGCAGCGGCCACGGCAATCACAGCGACAGCCGAGACACCTCTCCACAAGTCCCTGCTGTTTTCCT
ATCTGCAGGGTTGGGGTAGCCACTCGCAGCTGCGGCATCTGGCCTCGGCCATCGTCACGGACGGCTCACAGGCGGCACAT
TTGCGCGAGGTCTTTGACAAGGAGACGATGACGACGACGACGACGACGACGACGAAAACGACGACGACAACGACGACGAC
AACGACGACGACGACAGGACACGGCGGTACTGCTGGGGCGAACGGGATGACAGCCGCATCAAGACGTCTGTTGGAGCTCG
ACAGCACCAAATTTGGCGACTATAGCGACGACGAGTCCCCGCCACCATCACCGACTACAGCGGCCACCGATTCTGGATAT
GGGTCTGGCTCTACAGGCACAATACCGAACCCGGGGAACGATCCGGGCTTTCTCGAATCCGTTCCCCTTCGTCGACGGCT
GTTCTATCTGGTAAGACTTGTATTCTGTTTGGTTGATCCTACTTCCAAGTTCACGTAGGTCTTGTCTGACAATGCGGCCA
GGTTGTGCTTGCGGCCATGTGTTTCCCCGCAGACTTTGCGCCAGTTGACGTGGTCTACCGCACATTTGCCGACGTGCTGC
GGGAGACGGACGTGACCGTGTTCTCCTCGTTTGTCTCGCTGCCACCGCCGGCTGCGAGTGCAGCACTGTGGACAGCATCA
GCGCCACCGCCGATCACGGCCAACGACGCGTTTGTCGGCCTGTTTCGGCACATTCTCTTCACGGTACTGCCGCTGTCGGC
ACCGAAGCCACGGCTGGTGGACCCAGACGCAGACAGCCGCTTGAGCGTGTCGCAGCAGCTGTTGGAGCGCTGTTTCCTGC
CGTTTGCCGCGAACACGGTGGTGCTGGGGGCTAACGTGCGCATGGCGCTGGTGTTGGAGAGTCTGTTCCGCATCGTCTGG
GGGGCGGGACGAGGCAGCGGCGACAGCAGACAGCTCTGCTGGACGAAAGCTCTACAGGAGGCGGCAGAGGCGGGCGTGCG
GGCGCGCGAGGCTCGGCCACGGCCACCCAGGAAGAAGACGTTTGAGCTGGAGGCCTTTGGACAGGACCTGATGCGACGAT
CGGGTCGGCGGCTGCTGAGCATGGTGCAGCTGGCGAAGATGGAGGGGAGTGAAGAGGGAGGAGTGAGATGAGGAAAGAGG
GGCGAGACTCGAAAGAGACTTGACAAGATATCAAATATTGATAGACGACCGGATAAAGGCTATTGCTTTGGTTCACGTGG
TGTCCAAGCCTGAGGCTGCCATTTCTGACGACTGGGCTGCTCGGACTTCCAAGAGTCAGGAGGAGTGGCAGAAGGAAGAC
GATCGGTTTCCAAAGTTCGTTGTGGTTGTGAGGACTGTTCTGCTGGCAGCTGTGGAAGGACGAGACTGGGGCCCGAGTCG
ACACGTTTGGCCCCGGCCCAACGGGCGTCGGCAGCAGCGGCTAGCAGGCGCATCTGCTGCTGGCGGGCGAGTTCGTGGCG
CTGCTCGTCGAGAGAAGGGGGTTCGCGACGGGTGTGTCGGAGCCATTGATGCCATTGGGGCGGCACCTTCACGTCGCTGT
GGTGAGTGCCGCGGGGGTACTGGACGATGCGGCGCCAGCGGGCGGTGGCACTATCGTTGTGGCCGCGGATGTCGCGAAAC
TCCCAGTAGGTGTTGCCGTCGAGATCGTGACCTGGAAGTTAGAAGGAATTGTGAGGCTTCTCGGCTGCAAGTTCATCCAT
ACCGATCAGAAACTGCTTTCGCCACGGCAGGCGGAGAGCCTTCCAGCTCAACCAGAGCTGTGCGAAGCGGGATACGGACT
TCGGCATGACAGCAGTGATGACAGGACAGTATGTCCGGAGAATGGTGGGAATGGTGGATGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62