GenePrediction:GLEAN_1539 Details

Name: GLEAN_1539
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:501537..503822 (+ strand)
Length: 2286
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:501537..503416 (+ strand)
Length: 1880
Type: CDS
Source: GLEAN
Position: GCSC_82:503516..503822 (+ strand)
Length: 307
>GLEAN_1539 class=GenePrediction position=GCSC_82:501537..503822 (+ strand)
ATGGCGACGGTGTCATCGCTCGACGGCGACCTGCGGCGGCTGCGGCTGGACAAGTACACGCCGGCGGCGGCACGTGAAGC
ACGTGAATGGGTAGAGAGCGTGCTGGGCGAGCCGCTGAGCGGGAGCGACCTGCTGGACGGCCTGCGCGACGGGGTGGCGC
TGTGCCGGCTGGCGAACCTGGCCATGTCAGGACCGGGAATCCGGTTCAAGAAGTCGGCCATGCCGTTTGTGCAGATGGAG
AACATCTCGCACTTTCTGCGGGCATGCCAGGCGCCACCGCTCAGCCTGCAGCAGCACGACGTCTTCCTGACCGTGGACCT
GTACGAGGCCAAGGACCCGGCCCAGGTGCTGCAGTGTCTGATGGCCTTTAGCCGGGCGGCGAACCGCGTGAACCCGACCG
CGTTTCCGACCGCCATGGGGCCGCGGCCGAGCGGCCGAGCAGCCGGCGGTGGTGGCAGCACGGTCGGCGGCAATTCCGCT
GCTGTCGGGGCCTATACGGCCACGGCTGGCGGTTCGGGCGTGGGCGGGTCGGTCATCAGTCCGTCGAACTCGGCCGGGCT
CAACAATGGCGGCGGACGGAGCCCGACAACACAGCCGAGCACGTGGAGCAAGCGGAACATGGAGGGAGCGACGCCGACCG
CTCCGGCCTGGAACATTGCACAGTACGGCTACATTGGCGGCGCCAGCCAGGGCAACCTGGGCATCTCGTTTGGAGGTCGG
CGACAGATTACAAACTCGGAGCCCAAGGTGATGAGCCTGGCCGAACGCGAACGGCTGCGGAAGGCGAAGGAGGCCGAGAC
GGAGACGCGACAGAAGGCGAAGGAGGCCGAGACGGAGATGCGACAGAAGGCAAAAGAGGCCGAGGCGGAGACGCGACAAC
AAAAGGAGAAGGAGTCGGCAGCACAGGCAGCCAAGGCAGAGGAGAAGCGCAAGGCGGACGAGGAGCGGCGGCGATGGGAG
GAAGAGGAGAAGCAGTGGAAGCTGACGGAAGAGAAGCGACGCCGGGACGAGGCCGAGGCTGAAGCCCGTCTGGCCGAAGA
GCGACAGCGGCTACGAAGCAGCGGGAAGGCGACAGGCGGCATTGTGGCAGCAGCGATGACGACGACGACGACGACAGCGA
CGACAGCAACAACCGCAGCAACAGCAACAACAGCAGTCGGTGGACGAGACGGCCGTCTACACGGACAGCTCCTGAGCCAG
TACCAAGCCGAGCAGAACGGGACGAGCGGTGGAGGTGGAGGGAGCAAGCAGCCGCTGCGCCAACACGAGGACGAAGACAG
CCGTGGCGGATCAGCCTACAGCAACCGGGTGCGCGAGCTAGAACAGGAGCTGGAGCAGGCGCGACAGCGAGAGCAGGAAT
ACGAGCGCGAGCGACGAGGACGAGGGCCGACGGCGGCGGCGACCGGGCTCTCGGTAGACGAGGGCAAGGCGCGGTCTCGA
AGCCGGGCGCGATCGCGCAGCCAGGCACCCGGAACGGCCGGACAGCTCAAGAGTCCGGTGCCAAGCCGCCAGGATTCATG
GTCGCGTCACGAGCCCGAGATTTTGCGGACGCCTCGCAGTCGAAGTCGCCATCGGTTTGCCGACCAGGAGCCGCAGCGTG
TTGGTGGCGGCCTGGCCAGTCCGCTCAGCAGTCCACCGTTGGGGGCTAGCCGGCCAGGCAGCCAGCCGGTGAGCTCGCCG
GCACAGCCGTTGTCGCCGCGACCGCTGCCGGATCCACGAGCCAGCAGCCGCTTCGGCCAGCCACAATCGCCACAGCCACA
TCAGCCACAATCACCACACCAGCCACATCACGCCCCCGGCTTGGCCTCGCCCATCTCGCCACAGCTGCCGCCACGCAGCC
GTCCGCTGCCGAACCCGTCGGCCTACGCGGCGACGTCGTCGTCACGGCCGAGCACTGCGCTGCCGGGAAGCTTTCCGTCG
CCGTCGCCGTCGTCGTCGCCGCTGTCGCTGCGGTCACCGCCGAAGCAGCTGGGCGCTAGGCCGGTCACGAAACCGGGACA
GTCGCTGCTGGAACGCGAGATGGAGCTGGAACGCCAGCGCCAGCGCGAATGGGAGGATGCTCAGCAGGCAACGGCAGCGG
CAGCTGCCGGTCTCCAGCAGGCCACCGGCACCGGCACCGGCTCCAACAACAACAATGTCGACGGCATCGACGGCCGCTGG
GACGTCAGCCAGTGGGGCGGCTTCACCGGCGGCGACAGCCAGAACCGCGGGGCACAGGGCATCGGGGCTGGACGCCGACA
GATTGTCGGCCCGCGGCCGCTGCCGGGATTGCCCGGGCAGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62