GenePrediction:GLEAN_153 Details

Name: GLEAN_153
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1047088..1049038 (+ strand)
Length: 1951
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1047088..1047323 (+ strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_179:1047452..1047540 (+ strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_179:1047602..1047625 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_179:1047676..1047747 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_179:1047805..1048308 (+ strand)
Length: 504
Type: CDS
Source: GLEAN
Position: GCSC_179:1048368..1048528 (+ strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_179:1048595..1049038 (+ strand)
Length: 444
>GLEAN_153 class=GenePrediction position=GCSC_179:1047088..1049038 (+ strand)
ATGACCGAATCTGCAGACCCAACGCCAAATGATGACGGGGAGAATAATACCGGACTGGACAAGTTTGTGCCCGTGACGGG
CGCCAAGCTTTCCTTGCTCATCTTCAGCCTGTCTCTGAGCTGCTTTCTGATCTTGCTAGATACGTCCATTGTCTCGACGG
CGATCCCCAAAATTACAGATGATTTTCATTCCTTGTCTGATGTCGGCTGGTATGGCAGCGCCTACTTGTTGGGGAGGTAG
GCCATCTGTTCTGCATCCCAGTCAGTCCTCTCTATTAGTGGACATTCATTGGCTTCTTCTTCGTCTTTGAGCTGGGATCC
GCTCTCTGTGGTGCATCCCAGTCGTCCGTCATGCTGATTATAAGCCGGGCTATTGCTGGTGCCGGTGCCTCTGGCCTGAT
GAACGGCGCTCTAGTTATGCTGGCAGCGTCCGTGCCTTTGCAGAAGCGACCACGTGAGTACTTCACAACGAGATCATCCA
AATTGGAGCAGGGCTATCTGCTTACACAGCGCAGCTCTCACGGGTGTCATCATGGGCGGTATGTTGTGTTTTCACTCTTC
TCCTTTCAAATTTTGCTGACAAATCCAGTTGGCCAATTCGGCGTCGTTCTCGGTCCTCTCATCGGAGGTGCTTTCACCAC
TGGATACACCTGGAGATGGTGTACGTACTTTCTTGTCTTTCACTAGCTGGCCATACGCCTCCTTCTAACACGCTCAGGCT
TCTACATCAATCTTCCCCTCGGTCTCATCGTCGCTATCCCTTTGATCCTTCTCCACGTCCCCGAGCAGACGGCCAAGGAC
CGGCCTCTAACTGCTCTTCGCACCATCCATCGTCGCCTAGACCTCCTCGGATTTGTTCTCTTTGCCCCCGCCATCATCCA
ACTCCTGCTTGCTTTACAGTTTGGCGGTAGCCGGTACCCCTGGAAGTCATCCCAGGTGATTGGCCTCTTCTGCGGAGCCA
CCGCTACACTTGCAGTTTGGGGTATCTGGAACGCCTATTGGGGCCCCGGCGCGCTACTCAACTTTACCGTCATCCGCCGC
CGTCGTGTCTGGATAAGTGGTGTCTGCTACACAGCCCTTACTATTACCGTCTTCGGCTCGTCCTATTTTTTACCAATCTA
CTTCCAGGCCGTCAAGGGCGTCAGCGCCGTAATGAGCGGCGTCTATATGCTTGCTGGAATTCTGCCCCAGGTCGTTGCCA
GCGTCTCAGGAGGCATACTCGGTGAGAGCCCTTCCATTACGATGTCTCTTGTGTGCCCAAACACGCGCTGACATCCACAG
TTCCCAAGGTTGGCTACATACCGCCTTTTGTCCTCATCGCTGGTGTCTTTCTCGCTGTCAGCGGCGGCCTCTTTAGCCTC
TTCCAGCCAGGTACACCTACCAGCCAGTGGGTCGGGTACCAGATCCTTGCTGGTGTTGGCCGGGGAATCGGCTTTCAGAT
GGTGTGTCTGCAGACTCCTATTCGCCTTCTCTTCCCCACACACTCATCTATGTGCTCACCTTCCAAGCCCCTAATTGCCG
TCCAGCATAGCGTTTCGCCCGCAGAGCTCTCCGACGGCATGACGTTTGTCATCTTTTGTCAGTACATTGGCCCTGCAATC
TCTCTGACCGCATTCAACACCATCCTCGACTCCAGGCTGCAGGTGGAACTGCATAGGCTGGTTCCGGATATCAACCCAGG
ACTTGTGTTGAAAAATGGCGCCACTGGCTTCCGCAAGGTCGTCAGTACCCAGGATCTGCCGGGTGTCCTCAAGGCGTACT
CCAACAGTCTGGATATTATCTTTTACGTCATTGCTGGTGCCGGTTGCATCGTCTTCTTTTCGGGCTTCGGAATGGGCTGG
AACAACCTGGGAGACACTGCCAAGAAACCCGTGGCTGCCCTGATATCGTCTGCGAGATCGGCTCTAGGCGACGACGAAAA
ATCGGCAGAGTACACAGGGTCCGGTGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62