GenePrediction:GLEAN_1541 Details

Name: GLEAN_1541
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:526952..528574 (+ strand)
Length: 1623
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:526952..526988 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_82:527176..528309 (+ strand)
Length: 1134
Type: CDS
Source: GLEAN
Position: GCSC_82:528381..528574 (+ strand)
Length: 194
>GLEAN_1541 class=GenePrediction position=GCSC_82:526952..528574 (+ strand)
ATGGCGAGCCCTAGCACAACCTTGGACCCGATTGATGGTGAGTATCCACTGGTGAAGTGAAACTGGCCTGCTTTGTCAAC
AGCACTTCTGGGCACACCTCCTCCGAAGAGCCCGCCGCACTCGCCCTCCCCCCCGCTCAGCCTCGGCCGTGCTCCTGATT
TGTTCTCCCTCCACGCTGCCCTGACTTGGTATCGCACAGTTCCAGCTAAGAACCCGCTCAGCAGACGCTGCCGCGCCCTA
CGAGTACACGACGGACTTTTATGCCAGTGATCCTATCCTCGAGTGCCTCTACAGCTCCGGAGACGGCTCCTACATCCTCG
ACTTCGACGCACACCTCATACGGTTGTCACAACAGCCGTTCATGCGGGGTGCTGGGCCGGCTGCTTCGTATCCCTCCTCT
CAGCTGCCCGGCCGCACGACAGCCACGAGAACCTCGCTCGGAGACTCGGGTGACGCTCGCCGAAGCGGGCAACGTGGCGA
CGACAGCAGCCTTTCGGCCCCGACGCCGGCCGATGACTCAGTACTGCCGCCATTTCTGCAGTCCAGCCCACCCCGGACAT
CTCTTCCACAACAACAGCTGCCGCGAGACCGGCTCCGGCCATCGACACCCCGCGGCCCCGAATTGAACAGCGACGACTAC
CTTCAGCTTTTGGCCACGGATAACTTCTCCTCCCCATCCATCTTTGGCCGTGGAAGTCCAGCCGAGCGGACGACCCGGAG
CGGCTCACAGCCAAAGGTCGAGATACCAAGCACAGCACGACACCAGAAGTCAAGTCCGCTTGACAATATGCCACAGACTC
GGAGACGGTCAAGCGCGGCTGCGGCATCCAGGCTGCGGGGCGCCAGCACGGTTGCAAGCGGCAGCTCAGCTGCCGCTGCT
CTGCCTGGCTCTTACCCCGACGCCACCGCGTCGTCACCCATCACGGAGGCTTCGCCGACACGAACGCGGACTGCCGTAAA
GCGGAGACGAGGCGGCGAGCCGGTGACAGCAGCTTCTACTTCGGCATCGACATCAGCATCAGCGTCAGCATCAGCATCAG
CATACGCGACCTTACCATTACCAGCATCTTCCTCCACACCAGCAACCGGTGCCGATAGCAGTCGTACATCACACACACCA
AAGAAACGGCCACGGCGGGGAAACACCATCGTGCTGGACGACGACCTGTTCGGCTCGGACGACGACGGCATAGATGTCGT
CAACCTGACCGGGATTGATCGACCAGGCGCTGCCAGCCAGGAAGACGTAAAGGTCGCGATCGAGCCTACTCCGGCTCCCT
CGAACAAGGTCAAGCTAGCCAGCTATCAGTGCGCCATCTGCATGGACGACGTGACCAATCTCGTGGTCACGCATTGTGGT
GCGTGTTTGCTTTCCCCATCCGCAGAGTCTGTTCCCCCTCTTGGGCTGTTGCTGACATCACTCCTTCAGGCCATCTCTAC
TGCGGTACATGTCTGCACTCTTCGCTCTACATGGACGCATCGCGCAAGGCGTGTCCGATATGCCGGCAAAAGATCGAGCT
GCGCAGCTCGGGAGCGGCAAAGTCGGCACGCAGCTACTTTCCCCTGGAGCTGAAACTCATGACACGCAATCGGCAGGGCA
AGCAGCCAGCAAGACAGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62